rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name: Ceph18S Gene: 18S Length of Target: 150–190 get_seeds_local() minimum length: 105 get_seeds_local() maximum length: 235 blast_seeds() minimum length: 65 blast_seeds() maximum length: 195 max_to_blast: 100 Forward Sequence (5'-3'): CGCGGCGCTACATATTAGAC Reverse Sequence (5'-3'): GCACTTAACCGACCGTCGAC Reference: D. S. W. de Jonge, V. Merten, T. Bayer, O. Puebla, T. B. H. Reusch, H.-J. T. Hoving, A novel metabarcoding primer pair for environmental DNA analysis of Cephalopoda (Mollusca) targeting the nuclear 18S rRNA region. R. Soc. Open Sci. 8, 201388 (2021) https://doi.org/10.1098/rsos.201388 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.