Cnidarian ITS2 classifier compatible with insect R package version &gt;= 1.1.0

The file 'classifier.rds' contains an eDNA classifier for cndarian and demosponge ITS2 sequences generated with the primers SCLER5.8SForw (GARTCTTTGAACGCAAATGGC) and SCLER28SRev (GCTTATTAATATGCTTAAATTCAGCG) from Brian et al (2019) Elevated Symbiodiniaceae richness at Atauro Island (Timor-Leste): a highly biodiverse reef system. Coral Reefs 38:123-136. The 'trainingset' attribute contains the training data used to learn the classification tree, as a "DNAbin" list object with NCBI taxonomic ID numbers included in the sequence names. Please see https://cran.r-project.org/web/packages/insect/vignettes/insect-vignette.html for details and examples on using the package with pre-trained classifiers. Reference sequences and NCBI taxonomy database were downloaded 20 September 2018. Compatible with insect R package version >= 1.1.0

Related Organizations

Victoria University of Wellington
New Zealand

Keywords

eDNA, classification tree, ITS2, Cnidaria, Demospongiae

Impact byBIP!

	selected citations These citations are derived from selected sources. This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).	0
	popularity This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.	Average
	influence This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).	Average
	impulse This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.	Average