Riederberga sylviae Tedersoo sp. nov. Diagnosis. Separation from other species of Riederberga based on the ITS region (ITS 2 positions 186–215 gctttggacggcatgcgaatctgcatcaca; one mismatch allowed) and LSU (positions 656–685 tcaccaatcgacgtcaatcggcatgcgtct; one mismatch allowed) as indicated in Fig. 14. Type. Soil eDNA sample TUE 128372 (holotype); eDNA sequence: EUK 1602903 (lectotype); GSMc plot G 5783, wet grassland (soil sample TUE 028372) in Altnurga, Estonia, 58.55682 ° N, 26.29259 ° E. Description. Other sequences: EUK 1604046 and EUK 1604047 (both type locality); and GU 055683 (ITS part considered; managed grassland soil in Riederberg, Austria, 48.25 ° N, 16.07 ° E), collected by Sylvia Klaubauf (Klaubauf et al. 2010). Etymology. Riederberg (German) refers to type locality; and Sylvia (German) refers to the first name of Sylvia Klaubauf, who first collected the materials of type species and the entire order from the type habitat. Notes. Found in Austria and Estonia, with ITS and LSU sequences displaying up to 1 % differences.

Published as part of Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), pp. 249-271 in MycoKeys 107 on pages 249-271, DOI: 10.3897/mycokeys.107.125549