BioTechniquesVol. 37, No. 5 BenchmarksOpen AccessLINE-1 insertion dimorphisms identification by PCRWichai Pornthanakasem & Apiwat MutiranguraWichai PornthanakasemChulalongkorn University, Bangkok, Thailand & Apiwat Mutirangura *Address correspondence to: Apiwat Mutirangura, Genetics Unit, Department of Anatomy, Faculty of Medicine, Chulalongkorn University, Bangkok 10330, Thailand. e-mail: E-mail Address: mapiwat@chula.ac.thChulalongkorn University, Bangkok, ThailandPublished Online:6 Jun 2018https://doi.org/10.2144/04375BM07AboutSectionsPDF/EPUB ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinkedInReditEmail Differentiating between recent LINE-1 (L1) insertion dimorphisms (LIDs) is predominantly useful for studying not only the transposition mechanism but also population genetics based on polymorphic markers where ancestral state is known (i.e. absence of the insertion) (1–5). Las técnicas anteriores, como L1 display (1) o ATLAS (2), han identificado nuevos LID de distintas poblaciones. Para mejorar tanto la eficiencia como la simplicidad, diseñamos un enfoque basado en PCR, LA identificación de LID por PCR (LIDSIP), combinando y modificando la PCR mediada por ligación (LMPCR) (6) y la PCR de secuencia repetitiva intercalada (IRSPCR) (7). Este método requiere solo una pequeña cantidad de ADN, un número limitado y específico de PCR para proporcionar un escaneo de todo el genoma dentro de un rango de PCR de un sitio de restricción apropiado, técnicas genéticas moleculares convencionales como la electroforesis en gel de agarosa sin marcador radiactivo y, además, este método produce resultados específicos claros y fácilmente distinguibles. El objetivo de la aplicación de LIDSIP era mapear globalmente la L1 activa en el genoma humano amplificando el extremo de la región 3'no traducida (UTR) del subconjunto L1-Ta hasta su siguiente secuencia específica de reconocimiento de enzimas de restricción. En primer lugar, se digirieron 500 ng de ADN genómico humano con BstYI (New England Biolabs, Beverly, MA, EE. UU.) y se purificaron con extracción con fenol-cloroformo y precipitación con etanol. En segundo lugar, el ADN se ligó a 20 pmol de cada uno de LIDSIP-LINK (5'-AGGTAACGAGTCAGACCACCGACTCGTGGACGT-3') y BstYI-LINK (5'-GATCACGTCCACGAG-3') usando ADN ligasa T4 (New England Biolabs) a 16 °C durante la noche. Finalmente, 50 ng del ADN ligado purificado se sometieron a PCR anidada. La primera PCR (50 µL de volumen total) contenía 200 µM de cada uno de los cuatro dNTP, 1× amortiguador de PCR (contiene 1.5 mM de MgCl2; Qiagen, Valencia, CA, EUA), 0.1 U de HotStarTaq® (Qiagen), 0.4 µM de L1-ACA (5′ -GAGATCTACCTAATGCTAGATGACACA-3 ′) (1) y enlazador 5′ (5′-AGGTAACGAGTCAGACCACCACCGA-3′). La amplificación por PCR se realizó de la siguiente manera: desnaturalización inicial a 95 °C durante 15 min, seguida de 20 ciclos de desnaturalización a 95 °C durante 45 s, hibridación a 57 °C durante 45 s, extensión a 72 °C durante 2 min y una extensión final a 72 °C durante 7 min. Para dividir el número de tipos de productos en subconjuntos distinguibles por electroforesis, se realizaron 20 ciclos de PCR anidada utilizando 32 cebadores quiméricos diferentes. Este paso ayuda a fraccionar los productos repetitivos similares a los cebadores MseI 3+ en el polimorfismo de amplificación específico de secuencia (S-SAP), que se desarrolló para mostrar retrotransposones vegetales (8). Cada reacción consistió en 20 ciclos de amplificación que contenían 1 µL de producto de PCR primario, uno de 32 cebadores quiméricos [5′ -GACTCGTGGACGTGATC (C/T)XX-3′, donde (C/T) era C o T, y XX era 2 pb de secuencias seleccionadas aleatoriamente; por ejemplo, TGA quimérico es 5′ -GACTCGTGGACGTGATCTGA-3 ′], GCNP (1) y el cebador anidado L1, GCGCACCAGCATGGCACA. Esto se ilustra adicionalmente mediante el diagrama esquemático (Figura 1) y un ejemplo de LIDSIP (Figura 2a), respectivamente. Cuando se compararon los productos LIDSIP entre 14 individuos tailandeses, se pudieron identificar 37 LID candidatos. De media, cada PCR anidada arrojó 10 de un total de 300 productos por muestra. Se seleccionaron cinco LID candidatos, se clonaron en el vector de clonación pGEM-T easy (Promega, Madison, WI, EE. UU.) y se transformaron en Escherichia coli DH5α. La secuenciación de ADN se realizó en un secuenciador de ADN Abi 3100 (Applied Biosystems, Foster City, CA, EE. UU.) y los resultados se analizaron mediante el programa Basic Local Alignment Search Tool (BLAST) (www.ncbi.nih.gov/BLAST). Todos los clones revelaron L1 aguas arriba, sitio de integración, copia única y secuencias de cebadores quiméricos. Sin embargo, los resultados de BLAST carecían de L1 aguas arriba de la secuencia flanqueante, y solo los sitios de preintegración estaban realmente presentes en la base de datos del genoma humano (n .º de acceso de GenBank® AC015547 a 86,101 pb, AC087307 a 13,330 pb, AL392087 a 11,869 pb, AL583842 a 37,981 pb y AP001996 a 37,981 pb), lo que sugiere retrotransposiciones recientes. Se realizaron PCR de TAPA (1,2) y se confirmaron los polimorfismos de todos los marcadores (Figura 2b) .Figura 1. Identificación de dimorfismos de inserción de LINE-1 mediante diagrama de PCR (LIDSIP) .Un enlazador de PCR mediado por ligación modificado (LMPCR) (línea negra) se ligó a ADN genómico (línea gris) en el sitio BstYI. El subconjunto L1-Ta se ilustra como un triángulo negro. Las líneas discontinuas representan los productos primeros y anidados. Las flechas son cebadores. L1-ACA y GCNP son secuencias 3'de L1. El cebador enlazador es la secuencia 5'del enlazador. El cebador quimérico es la secuencia 3'del enlazador y el sitio de restricción más una secuencia aleatoriamente única de dos nucleótidos, ilustrada como X.Figura 2. Identificación de dimorfismos de inserción de LINE-1 mediante PCR (LIDSIP) y PCR de dimorfismo de inserción de LINE-1 (LID).(A) Productos LIDSIP de cuatro individuos, carriles 1–4. Cada uno se identificó mediante dos cebadores quiméricos diferentes, quimérico de TGA y quimérico de TCG. Los LID candidatos se indicaron en las flechas. M es la escalera de ADN m24 de 100 pb + 1,5 kb (SibEnzyme, Novosibirsk, Rusia). (B) Dos PCR de LID demostraron polimorfismos entre seis individuos diferentes, carriles 1–6. M es la escalera de ADN m24 de 100 pb + 1,5 kb. La aplicación de LIDSIP ha mejorado tanto la simplicidad como la eficacia en comparación con las dos técnicas de PCR anteriores. La primera, L1 display (1), analiza los LID mediante PCR utilizando cebadores arbitrarios, análisis de transferencia Southern e hibridación para la identificación. Cada PCR produce un número limitado de productos. Por lo tanto, para cubrir todo el genoma humano, la técnica requiere tanto una cantidad significativa de ADN como un número significativo de PCR. Tanto ATLAS como LIDSIP aplican el mismo principio de PCR de sitio único y producen más secuencias dependiendo de los sitios de enzimas de restricción junto a L1. Debido a la gran cantidad de plantillas de tamaño variable, con ATLAS, esos productos deben etiquetarse con [γ-33P]ATP radiactivo y separarse mediante electroforesis en gel de poliacrilamida de largo alcance desnaturalizante. Con LIDSIP, no se requiere marcaje radiactivo y la recuperación del gel se facilita en gran medida. Por lo tanto, al dividir los productos L1 en varios subconjuntos con PCR anidada utilizando cebadores quiméricos, se hace factible la diferenciación de tamaño mediante electroforesis en gel de agarosa. Además, LIDSIP puede limitar la utilización del ADN original por la PCR anidada cuando se necesita la reproducción de LA recuperación del PÁRPADO. La simplicidad de LIDSIP no solo ampliará globalmente la tasa de descubrimiento, sino que también, al ajustar las enzimas de restricción y los cebadores quiméricos anidados, el principio metodológico de S-SAP se puede modificar para identificar inserciones polimórficas del genoma de otros elementos móviles (8) .ReconocimientosEste estudio ha sido apoyado por el programa de doctorado Royal Golden Jubilee, Unidad de Investigación de Biología Molecular y Genética del Desarrollo del Cáncer, Universidad de Chulalongkorn y los Fondos de Investigación de Tailandia. Agradecemos a la Sra. Petra Hirsch por su revisión crítica del manuscrito.Declaración de intereses en competenciaLos autores declaran que no hay conflictos de intereses.Referencias1. Sheen, F.M., S.T. Sherry, G.M. Risch, M. Robichaux, I. Nasidze, M. Stoneking, M.A. Batzer y G.D. Swergold. 2000. Reading between the Lines: human genomic variation induced by LINE-1 retrotransposition. Genome Res. 10:1496-1508. Crossref, Medline, CAS, Google Scholar2. Badge, R.M., R.S. Alisch y J.V. Moran. 2003. ATLAS: un sistema para identificar selectivamente inserciones L1 específicas de humanos. Am. J. Hum. Genet. 72:823–838.Crossref, Medline, CAS, Google Scholar3. Smit, A.F. 1999. Repeticiones intercaladas y otros recuerdos de elementos transponibles en genomas de mamíferos. Curr. Opin. Genet. Dev. 9:657-663. Crossref, Medline, CAS, Google Scholar4. Kazazian, H.H., Jr., y J.V. Moran. 1998. The impact of L1 retrotransposons on the human genome. Nat. Genet. 19:19–24.Crossref, Medline, CAS, Google Scholar5. Sassaman, D.M., B.A. Dombroski, J.V. Moran, M.L. Kimberland, T.P. Naas, R.J. DeBerardinis, A. Gabriel, G.D. Swergold y H.H. Kazazian, Jr. 1997. Muchos elementos L1 humanos son capaces de retrotransposición. Nat. Genet. 16: 37-43. Crossref, Medline, CAS, Google Scholar6. Mueller, P.R. y B. Wold. 1989. Huella in vivo de un potenciador específico muscular mediante PCR mediada por ligación. Science 246: 780-786. Crossref, Medline, CAS, Google Scholar7. Nelson, D.L., S.A. Ledbetter, L. Corbo, M.F. Victoria, R. Ramirez-Solis, T.D. Webster, D.H. Ledbetter y C.T. Caskey. 1989. Alu polymerase chain reaction: a method for rapid isolation of human-specific sequences from complex DNA sources. Proc. Natl. Acad. Sci. EE. UU. 86: 6686-6690. Crossref, Medline, CAS, Google Scholar8. Leigh, F., R. Kalendar, V. Lea, D. Lee, P. Donini y A.H. Schulman. 2003. Comparación de la utilidad de las familias de retrotransposones de cebada para el análisis genético mediante técnicas de marcadores moleculares. Mol. Genet. Genomics 269: 464-474.Crossref, Medline, CAS, Google ScholarFiguresReferencesRelatedDetailsCited ByOngoing efforts to detect mobilization of transposable elementsBMB Reports, Vol. 55, No. 7El silenciamiento dinámico de las inserciones de retrotransposones somáticos L1 refleja los contextos de desarrollo y celulares de su integración genómica10 de mayo de 2017 | Mobile DNA, Vol. 8, No. 1Las secuencias intragénicas de elementos intercalados largos-1 promueven la hipermetilación del promotor en el adenocarcinoma de pulmón, el mieloma múltiple y el cáncer de próstata31 de agosto de 2012 | Genes & Genomics, Vol. 34, No. 5Human Transposon TectonicsCell, Vol. 149, No. 4Los retrovirus endógenos de ratón pueden desencadenar la terminación transcripcional prematura a distancia23 de febrero de 2012 | Genome Research, Vol. 22, No. 5Hypomethylation of Intragenic LINE-1 Represses Transcription in Cancer Cells through AGO215 March 2011 | PLoS ONE, Vol. 6, No. 3 Vol. 37, No. 5 Síguenos en las redes sociales para conocer las últimas actualizaciones Métricas Descargadas 368 veces Historial Recibido 3 de junio de 2004 Aceptado 28 de junio de 2004 Publicado en línea 6 de junio de 2018 Publicado en forma impresa Noviembre de 2004 Información© 2004 Autor(es) AgradecimientosEste estudio ha sido respaldado por el programa de doctorado Royal Golden Jubilee, Biología Molecular y Unidad de Investigación de Genética del Desarrollo del Cáncer, Universidad de Chulalongkorn y los Fondos de Investigación de Tailandia. Agradecemos a la Sra. Petra Hirsch por su revisión crítica del manuscrito. Declaración de intereses en competencia. Los autores declaran que no hay conflictos de intereses. Descargar PDF

BioTechniquesVol.37, No. 5 BenchmarksOpen AccessLINE-1 insertion dimorphisms identification by PCRWichai Pornthanakasem & Apiwat MutiranguraWichai PornthanakasemChulalongkorn University, Bangkok, Thailand & Apiwat Mutirangura *Address correspondence to : Apiwat Mutirangura, Genetics Unit, Department of Anatomy, Faculty of Medicine, Chulalongkorn University, Bangkok 10330, Thailand. e-mail : mapiwat@chula.ac.thChulalongkorn University, Bangkok, ThailandPublished Online :6 Jun 2018https://doi.org/10.2144/04375BM07AboutSectionsPDF/EPUB ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinkedInRedditEmail Differentiating between recent LINE-1 (L1) insertion dimorphisms (LIDS) is primarily useful for study not only the transposition mechanism but also population genetics or evolution based on polymorphic markers where the ancestral state is known (i.e. the insertion of the absence) (1–5). Des techniques antérieures telles que l'affichage L1 (1) ou ATLAS (2) ont identifié de nouveaux LID à partir de populations distinctes. Pour améliorer à la fois l'efficacité et la simplicité, nous avons conçu une approche basée sur la PCR, l'identification du LID par PCR (LIDSIP), en combinant et en modifiant la PCR à médiation par ligature (LMPCR) (6) et la PCR à séquence répétitive intercalée (IRSPCR) (7). Cette méthode ne nécessite qu'une petite quantité d'ADN, un nombre limité et spécifique de PCR pour fournir un balayage à l'échelle du génome dans une plage de PCR d'un site de restriction approprié, des techniques génétiques moléculaires conventionnelles telles que l'électrophorèse sur gel d'agarose dépourvue de marqueur radioactif, et en outre, cette méthode donne des résultats clairs, facilement distinguables et spécifiques. L'objectif de l'application de LIDSIP était de cartographier globalement la L1 active dans le génome humain en amplifiant l'extrémité de la région 3′ non traduite (UTR) du sous-ensemble L1-Ta jusqu'à ses prochaines séquences spécifiques de reconnaissance de l'enzyme de restriction. Dans un premier temps, 500 ng d'ADN génomique humain ont été digérés par BstYI (New England Biolabs, Beverly, MA, USA) et purifiés par extraction au phénol-chloroforme et précipitation à l'éthanol. Deuxièmement, l'ADN a été ligaturé à 20 pmol de LIDSIP-LINK (5′ -AGGTAACGAGTCAGACCACCGACTCGTGGACGT-3 ′) et de BstYI-LINK (5 ′ -GATCACGTCCACGAG-3 ′) à l'aide de l'ADN ligase T4 (New England Biolabs) à 16 °C pendant la nuit. Enfin, 50 ng de l'ADN ligaturé purifié ont été soumis à une PCR nichée. La première PCR (volume total de 50 µL) contenait 200 µM chacun des quatre dNTP, 1× tampon PCR (contient 1,5 mM MgCl2 ; Qiagen, Valencia, CA, USA), 0,1 U HotStarTaq ® (Qiagen), 0,4 µM de L1-ACA (5′ -GAGATCTACCTAATGCTAGATGACACA-3 ′) (1) et 5′ linker (5′-AGGTAACGAGTCAGACCACCGA-3′). L'amplification PCR a été réalisée comme suit : dénaturation initiale à 95°C pendant 15 min, suivie de 20 cycles de dénaturation à 95°C pendant 45 s, recuit à 57°C pendant 45 s, extension à 72°C pendant 2 min, et une extension finale à 72°C pendant 7 min. Pour diviser le nombre de types de produits en sous-ensembles distinguables par électrophorèse, 20 cycles de PCR imbriqués ont été effectués à l'aide de 32 amorces chimériques différentes. Cette étape permet de fractionner les produits répétitifs similaires aux amorces MseI 3+ dans le polymorphisme d'amplification spécifique à la séquence (S-SAP), qui a été développé pour afficher les rétrotransposons végétaux (8). Chaque réaction consistait en 20 cycles d'amplification contenant 1 µL de produit de PCR primaire, l'une des 32 amorces chimériques [5′ -GACTCGTGGACGTGATC (C/T)XX-3′, où (C/T) était C ou T, et XX était 2 pb de séquences sélectionnées au hasard ; par exemple, TGA chimérique est 5′ -GACTCGTGGACGTGATCTGA-3 ′], GCNP (1), et l'amorce imbriquée L1, GCGCACCAGCATGGCACA. Ceci est en outre illustré par le diagramme schématique (Figure 1) et un exemple de LIDSIP (Figure 2a), respectivement. Lorsque les produits LIDSIP ont été comparés entre 14 personnes thaïlandaises, 37 lid candidats ont pu être identifiés. En moyenne, chaque PCR imbriquée a donné 10 produits sur un total de 300 par échantillon. Cinq lid candidats ont été sélectionnés, clonés au vecteur de clonage facile pGEM-T (Promega, Madison, WI, USA), et transformés en Escherichia coli DH5α. Le séquençage de l'ADN a été effectué sur un séquenceur d'ADN ABI 3100 (Applied Biosystems, Foster City, CA, États-Unis), et les résultats ont été analysés par le programme Basic Local Alignment Search Tool (BLAST) (www.ncbi.nih.gov/BLAST). Tous les clones ont révélé une L1 en amont, un site d'intégration, une copie unique et des séquences d'amorces chimériques. Néanmoins, les résultats BLAST étaient dépourvus de L1 en amont de la séquence flanquante, et seuls les sites de pré-intégration étaient effectivement présents dans la base de données du génome humain (GenBank® accession n ° AC015547 à 86 101 pb, AC087307 à 13 330 pb, AL392087 à 11 869 pb, AL583842 à 37 981 pb, et AP001996 à 37 981 pb), suggérant des rétrotranspositions récentes. Des PCR DU COUVERCLE (1,2) ont été réalisées et les polymorphismes de tous les marqueurs ont été confirmés (Figure 2b).Figure 1. Diagramme D'IDENTIFICATION des dimorphismes D'INSERTION DE LINE-1 par PCR (LIDSIP) Un lieur PCR modifié par ligature (LMPCR) (ligne noire) a été ligaturé à l'ADN génomique (ligne grise) au site BstYI. Le sous-ensemble L1-Ta est illustré par un triangle noir. Les lignes en pointillés représentent les premiers produits et les produits imbriqués. Les flèches sont des amorces. L1-ACA et GCNP sont des séquences 3′ de L1. L'amorce du lieur est la séquence 5′ du lieur. L'amorce chimérique est la séquence 3′ du lieur et du site de restriction plus une séquence aléatoirement unique de deux nucléotides, illustrée par X.Figure 2. Identification des dimorphismes d'insertion de LINE-1 par PCR (LIDSIP) et par PCR du dimorphisme d'insertion de LINE-1 (LID).(A) Produits LIDSIP de quatre personnes, voies 1–4. Chacune a été identifiée par deux amorces chimériques différentes, TGA chimérique et TCG chimérique. Les lid candidats ont été indiqués sur les flèches. M est l'échelle d'ADN M24 de 100 pb + 1,5 kb (SibEnzyme, Novossibirsk, Russie). (B) Deux PCR LID ont démontré des polymorphismes chez six individus différents, voies 1 à 6. M est l'échelle d'ADN M24 de 100 pb + 1,5 kb. L'application de LIDSIP a amélioré à la fois la simplicité et l'efficacité par rapport aux deux techniques de PCR précédentes. Le premier, l'affichage L1 (1), les écrans pour les lid par PCR en utilisant des amorces arbitraires, l'analyse par Southern blot et l'hybridation pour l'identification. Chaque PCR donne un nombre limité de produits. Par conséquent, pour couvrir l'ensemble du génome humain, la technique nécessite à la fois une quantité importante d'ADN et un nombre important de PCR. ATLAS ET LIDSIP appliquent le même principe de PCR à site unique et produisent plus de séquences en fonction des sites de l'enzyme de restriction à côté de L1. En raison du grand nombre de modèles à taille variable, avec ATLAS, ces produits doivent être étiquetés avec de l'ATP [γ-33P] radioactif et séparés par électrophorèse sur gel de polyacrylamide à longue portée dénaturant. Avec le LIDSIP, le marquage radioactif n'est pas nécessaire et la récupération du gel est grandement facilitée. Par conséquent, en divisant les produits L1 en plusieurs sous-ensembles avec une PCR imbriquée à l'aide d'amorces chimériques, la différenciation de taille par électrophorèse sur gel d'agarose devient possible. De plus, le LIDSIP est capable de limiter l'utilisation de l'ADN d'origine par la PCR imbriquée lorsqu'il est nécessaire de reproduire la récupération DU COUVERCLE. La simplicité du LIDSIP augmentera non seulement le taux de découverte à l'échelle mondiale, mais également, en ajustant les enzymes de restriction et les amorces chimériques imbriquées, le principe méthodologique du S-SAP peut être modifié pour identifier les insertions génomiques polymorphes d'autres éléments mobiles (8). RemerciementsCette étude a été soutenue par le programme de doctorat Royal Golden Jubilee, l'Unité de recherche sur la biologie moléculaire et la génétique du développement du cancer, l'Université Chulalongkorn et les Fonds de recherche de Thaïlande. Nous remercions Mme Petra Hirsch pour son examen critique du manuscrit. Déclaration d'intérêts concurrentsLes auteurs ne déclarent aucun conflit d'intérêts. Références1. Sheen, F.M., S.T. Sherry, G.M. Risch, M. Robichaux, I. Nasidze, M. Stoneking, M.A. Batzer et G.D. Swergold. 2000. Reading between the liness : human genomic variation induced by LINE-1 retrotransposition. Genome Res. 10: 1496-1508.Crossref, Medline, cas, Google Scholar2. Badge, R.M., R.S. Alisch et J.V. Moran. 2003. ATLAS : a system to selective identify human-specific L1 insertions. Am. J. Hum. Genet. 72:823–838.Crossref, Medline, cas, Google Scholar3. Smit, A.F. 1999. Répétitions entrecoupées et autres souvenirs d'éléments transposables dans les génomes de mammifères. Curr. Opin. Genet. Dev. 9:657–663.Crossref, Medline, cas, Google Scholar4. Kazazian, H.H., Jr., et J.V. Moran. 1998. The impact of L1 retrotransposons on the human genome. Nat. Genet. 19:19–24.Crossref, Medline, cas, Google Scholar5. Sassaman, D.M., B.A. Dombroski, J.V. Moran, M.L. Kimberland, T.P. Naas, R.J. DeBerardinis, A. Gabriel, G.D. Swergold et H.H. Kazazian, Jr. 1997. De nombreux éléments L1 humains sont capables de rétrotransposition. Nat. Genet. 16:37–43.Crossref, Medline, cas, Google Scholar6. Mueller, P.R. et B. Wold. 1989. In vivo footprinting of a muscle specific enhancer by ligation mediated PCR. Science 246:780–786.Crossref, Medline, cas, Google Scholar7. Nelson, D.L., S.A. Ledbetter, L. Corbo, M.F. Victoria, R. Ramirez-Solis, T.D. Webster, D.H. Ledbetter et C.T. Caskey. 1989. Alu polymerase chain reaction : a method for rapid isolation of human-specific sequences from complex DNA sources. Proc. Natl. Acad. Sci. USA 86:6686–6690.Crossref, Medline, cas, Google Scholar8. Leigh, F., R. Kalendar, V. Lea, D. Lee, P. Donini et A.H. Schulman. 2003. Comparison of the utility of orge retrotransposon families for genetic analysis by molecular marker techniques. Mol. Genet. Genomics 269: 464-474.Crossref, Medline, cas, Google ScholarFiguresReferencesRelatedDetailsCited ByOngoing efforts to detect mobilization of transposable elementsBMB Reports, Vol. 55, No. 7Dynamic silencing of somatic L1 retrotransposon insertions reflect the developmental and cellular contexts of their genomic integration10 May 2017 | Mobile DNA, Vol. 8, No. 1Intragenic long interspersed element-1 sequences promote promoteur hypermethylation in lung adenocarcinoma, multiple myeloma and prostate cancer31 August 2012 | Genes & Genomics, Vol. 34, No. 5Human Transposon TectonicsCell, Vol. 149, No. 4Mouse endogenous retroviruses can trigger premature transcriptional termination at a distance23 February 2012 | Genome Research, Vol. 22, No. 5Hypomethylation of Intragenic LINE-1 Represses Transcription in Cancer Cells through AGO215 March 2011 | PLoS ONE, Vol. 6, No. 3 Vol. 37, No. 5 Follow us on social media for the latest updates Metrics Downloaded 368 times History Received 3 June 2004 Accepted 28 June 2004 Published online 6 June 2018 Published in print November 2004 Information© 2004 Author(s) AcknowledementsThis study has been supported by the Royal Golden Jubilee Ph.D. program, Molecular Biology and Genetics of Cancer Development Research Unit, Chulalongkorn University, and the Thailand Research Funds. Nous remercions Mme Petra Hirsch pour son examen critique du manuscrit.Déclaration d'intérêts concurrentsLes auteurs ne déclarent aucun conflit d'intérêts.Téléchargement PDF

BioTechniquesVol. 37, No. 5 BenchmarksOpen AccessLINE-1 insertion dimorphisms identification by PCRWichai Pornthanakasem & Apiwat MutiranguraWichai PornthanakasemChulalongkorn University, Bangkok, Thailand & Apiwat Mutirangura*Address correspondence to: Apiwat Mutirangura, Genetics Unit, Department of Anatomy, Faculty of Medicine, Chulalongkorn University, Bangkok 10330, Thailand. e-mail: E-mail Address: mapiwat@chula.ac.thChulalongkorn University, Bangkok, ThailandPublished Online:6 Jun 2018https://doi.org/10.2144/04375BM07AboutSectionsPDF/EPUB ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinkedInRedditEmail Differentiating between recent LINE-1 (L1) insertion dimorphisms (LIDs) is predominantly useful for studying not only the transposition mechanism but also population genetics or evolution based on polymorphic markers where the ancestral state is known (i.e., absence of the insertion) (1–5). Previous techniques such as L1 display (1) or ATLAS (2) have identified new LIDs from distinct populations. To improve both efficiency and simplicity, we designed a PCR-based approach, LID identification by PCR (LIDSIP), by combining and modifying ligation-mediated PCR (LMPCR) (6) and interspersed repetitive sequence PCR (IRSPCR) (7). This method requires only a small amount of DNA, a limited and specific number of PCRs to provide a genome-wide scan within a PCR range of an appropriate restriction site, conventional molecular genetic techniques such as agarose gel electrophoresis devoid of radioactive label, and in addition, this method yields clear, easily distinguishable, specific results.The aim of applying LIDSIP was to globally map active L1 in the human genome by amplifying the 3′ untranslated region (UTR) end of the L1-Ta subset up to its next specific restriction enzyme recognition sequences. First, 500 ng human genomic DNA were digested with BstYI (New England Biolabs, Beverly, MA, USA) and purified with phenol-chloroform extraction and ethanol precipitation. Second, the DNA was ligated to 20 pmol each of LIDSIP-LINK (5′-AGGTAACGAGTCAGACCACCGACTCGTGGACGT-3′) and BstYI-LINK (5′-GATCACGTCCACGAG-3′) using T4 DNA ligase (New England Biolabs) at 16°C overnight. Finally 50 ng of the purified ligated DNA were subjected to nested PCR. The first PCR (50 µL total volume) contained 200 µM each of the four dNTPs, 1× PCR buffer (contains 1.5 mM MgCl2; Qiagen, Valencia, CA, USA), 0.1 U HotStarTaq® (Qiagen), 0.4 µM of L1-ACA (5′-GAGATCTACCTAATGCTAGATGACACA-3′) (1), and 5′ linker (5′-AGGTAACGAGTCAGACCACCGA-3′). The PCR amplification was performed as follows: initial denaturation at 95°C for 15 min, followed by 20 cycles of denaturation at 95°C for 45 s, annealing at 57°C for 45 s, extension at 72°C for 2 min, and a final extension at 72°C for 7 min. To divide the number of product types into subsets distinguishable by electrophoresis, 20 cycles of nested PCR were performed using 32 different chimeric primers. This step helps fractionate the repetitive products similar to MseI 3+ primers in sequence-specific amplification polymorphism (S-SAP), which was developed to display plant retrotransposons (8). Each reaction consisted of 20 amplification cycles containing 1 µL primary PCR product, one of 32 chimeric primers [5′-GACTCGTGGACGTGATC(C/T)XX-3′, where (C/T) was C or T, and XX was 2 bp of randomly selected sequences; e.g., TGA chimeric is 5′-GACTCGTGGACGTGATCTGA-3′], GCNP (1), and the L1-nested-primer, GCGCACCAGCATGGCACA. This is further illustrated by the schematic diagram (Figure 1) and an example of LIDSIP (Figure 2a), respectively. When LIDSIP products were compared among 14 Thai individuals, 37 candidate LIDs could be identified. On average, each nested PCR yielded 10 out of a total of 300 products per sample. Five candidate LIDs were selected, cloned to the pGEM-T easy cloning vector (Promega, Madison, WI, USA), and transformed into Escherichia coli DH5α. DNA sequencing was performed on an ABI 3100 DNA sequencer (Applied Biosystems, Foster City, CA, USA), and results were analyzed by Basic Local Alignment Search Tool (BLAST) program (www.ncbi.nih.gov/BLAST). All clones revealed upstream L1, integration site, single copy, and chimeric primer sequences. Nevertheless, the BLAST results were devoid of L1 upstream of the flanking sequence, and only the preintegration sites were actually present in the human genome database (GenBank® accession nos. AC015547 at 86,101 bp, AC087307 at 13,330 bp, AL392087 at 11,869 bp, AL583842 at 37,981 bp, and AP001996 at 37,981 bp), suggesting recent retrotranspositions. LID PCRs (1,2) were performed, and polymorphisms of all markers were confirmed (Figure 2b).Figure 1. LINE-1 insertion dimorphisms identification by PCR (LIDSIP) diagram.A modified ligation-mediated PCR (LMPCR) linker (black line) was ligated to genomic DNA (grey line) at the BstYI site. The L1-Ta subset is illustrated as a black triangle. The dashed lines represent the first and nested products. The arrows are primers. L1-ACA and GCNP are 3′ sequences of L1. The linker primer is the 5′ sequence of the linker. The chimeric primer is the 3′ sequence of the linker and the restriction site plus a randomly unique sequence of two nucleotides, illustrated as X.Figure 2. LINE-1 insertion dimorphisms identification by PCR (LIDSIP) and LINE-1 insertion dimorphism (LID) PCR.(A) LIDSIP products from four individuals, lanes 1–4. Each was identified by two different chimeric primers, TGA chimeric and TCG chimeric. Candidate LIDs were indicated at the arrows. M is the M24 100-bp + 1.5-kb DNA ladder (SibEnzyme, Novosibirsk, Russia). (B) Two LID PCRs demonstrated polymorphisms among six different individuals, lanes 1–6. M is the M24 100-bp + 1.5-kb DNA ladder.Applying LIDSIP has improved both simplicity and efficacy compared with the two previous PCR techniques. The first, L1 display (1), screens for LIDs by PCR using arbitary primers, Southern blot analysis, and hybridization for identification. Each PCR yields a limited number of products. Therefore, to cover the whole human genome, the technique requires both a significant amount of DNA and number of PCRs. Both ATLAS and LIDSIP apply the same principle of single-site PCR and yield more sequences depending on restriction enzyme sites next to L1. Because of the large number of size-variable templates, with ATLAS, those products have to be labeled with radioactive [γ-33P]ATP and separated by denaturing long-range polyacrylamide gel electrophoresis. With LIDSIP, radioactive labeling is not required, and gel recovery is greatly facilitated. Hence, by dividing L1 products into several subsets with nested PCR using chimeric primers, size differentiation by agarose gel electrophoresis becomes feasible. Additionally, LIDSIP is able to limit utilization of the original DNA by the nested PCR when reproducing LID recovery is needed. The simplicity of LIDSIP will not only globally expand the discovery rate, but also, by adjusting restriction enzymes and nested chimeric primers, the methodological principle of S-SAP can be modified to identify polymorphic genome insertions of other mobile elements (8).AcknowledgmentsThis study has been supported by the Royal Golden Jubilee Ph.D. program, Molecular Biology and Genetics of Cancer Development Research Unit, Chulalongkorn University, and the Thailand Research Funds. We thank Ms. Petra Hirsch for her critical review of the manuscript.Competing Interests StatementThe authors declare no conflicts of interest.References1. Sheen, F.M., S.T. Sherry, G.M. Risch, M. Robichaux, I. Nasidze, M. Stoneking, M.A. Batzer, and G.D. Swergold. 2000. Reading between the LINEs: human genomic variation induced by LINE-1 retrotransposition. Genome Res. 10:1496–1508.Crossref, Medline, CAS, Google Scholar2. Badge, R.M., R.S. Alisch, and J.V. Moran. 2003. ATLAS: a system to selectively identify human-specific L1 insertions. Am. J. Hum. Genet. 72:823–838.Crossref, Medline, CAS, Google Scholar3. Smit, A.F. 1999. Interspersed repeats and other mementos of transposable elements in mammalian genomes. Curr. Opin. Genet. Dev. 9:657–663.Crossref, Medline, CAS, Google Scholar4. Kazazian, H.H., Jr., and J.V. Moran. 1998. The impact of L1 retrotransposons on the human genome. Nat. Genet. 19:19–24.Crossref, Medline, CAS, Google Scholar5. Sassaman, D.M., B.A. Dombroski, J.V. Moran, M.L. Kimberland, T.P. Naas, R.J. DeBerardinis, A. Gabriel, G.D. Swergold, and H.H. Kazazian, Jr. 1997. Many human L1 elements are capable of retrotransposition. Nat. Genet. 16:37–43.Crossref, Medline, CAS, Google Scholar6. Mueller, P.R. and B. Wold. 1989. In vivo footprinting of a muscle specific enhancer by ligation mediated PCR. Science 246:780–786.Crossref, Medline, CAS, Google Scholar7. Nelson, D.L., S.A. Ledbetter, L. Corbo, M.F. Victoria, R. Ramirez-Solis, T.D. Webster, D.H. Ledbetter, and C.T. Caskey. 1989. Alu polymerase chain reaction: a method for rapid isolation of human-specific sequences from complex DNA sources. Proc. Natl. Acad. Sci. USA 86:6686–6690.Crossref, Medline, CAS, Google Scholar8. Leigh, F., R. Kalendar, V. Lea, D. Lee, P. Donini, and A.H. Schulman. 2003. Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques. Mol. Genet. Genomics 269:464–474.Crossref, Medline, CAS, Google ScholarFiguresReferencesRelatedDetailsCited ByOngoing endeavors to detect mobilization of transposable elementsBMB Reports, Vol. 55, No. 7Dynamic silencing of somatic L1 retrotransposon insertions reflects the developmental and cellular contexts of their genomic integration10 May 2017 | Mobile DNA, Vol. 8, No. 1Intragenic long interspersed element-1 sequences promote promoter hypermethylation in lung adenocarcinoma, multiple myeloma and prostate cancer31 August 2012 | Genes & Genomics, Vol. 34, No. 5Human Transposon TectonicsCell, Vol. 149, No. 4Mouse endogenous retroviruses can trigger premature transcriptional termination at a distance23 February 2012 | Genome Research, Vol. 22, No. 5Hypomethylation of Intragenic LINE-1 Represses Transcription in Cancer Cells through AGO215 March 2011 | PLoS ONE, Vol. 6, No. 3 Vol. 37, No. 5 Follow us on social media for the latest updates Metrics Downloaded 368 times History Received 3 June 2004 Accepted 28 June 2004 Published online 6 June 2018 Published in print November 2004 Information© 2004 Author(s)AcknowledgmentsThis study has been supported by the Royal Golden Jubilee Ph.D. program, Molecular Biology and Genetics of Cancer Development Research Unit, Chulalongkorn University, and the Thailand Research Funds. We thank Ms. Petra Hirsch for her critical review of the manuscript.Competing Interests StatementThe authors declare no conflicts of interest.PDF download

BioTechniquesVol. 37, No. 5 BenchmarksOpen AccessLINE -1 insertion dimorphisms identification by PCRWichai Pornthanakasem & Apiwat MutiranguraWichai PornthanakasemChulalongkorn University, Bangkok, Thailand & Apiwat Mutirangura *address correspondence to: Apiwat Mutirangura, Department of Anatomy, Faculty of Medicine, Chulalongkorn University, Bangkok 10330, Thailand. Email Address: mapiwat@chula.ac.thChulalongkorn University, Bangkok, ThailandPublished Online:6 Jun 2018https://doi.org/10.2144/04375BM07AboutSectionsPDF/EPUB ToolsAdd to favouritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinkedInReddEmailiating between recent LIN -1E (LIN -1) Dimorphorisms (LIDs predinomin) is only useful useful for the transposation but based also on evolutionor markors (1–5). وقد حددت التقنيات السابقة مثل عرض المستوى 1 (1) أو أطلس (2) معرفات جديدة من مجموعات سكانية متميزة. لتحسين كل من الكفاءة والبساطة، قمنا بتصميم نهج قائم على تفاعل البوليميراز المتسلسل، وتحديد الغطاء عن طريق تفاعل البوليميراز المتسلسل (LIDSIP)، من خلال الجمع بين وتعديل تفاعل البوليميراز المتسلسل بوساطة الربط (LMPCR) (6) والتسلسل المتكرر المتقطع (IRSPCR) (7). تتطلب هذه الطريقة فقط كمية صغيرة من الحمض النووي، وعددًا محدودًا ومحددًا من تفاعلات البوليميراز المتسلسل لتوفير مسح على نطاق الجينوم ضمن نطاق تفاعل البوليميراز المتسلسل في موقع تقييد مناسب، والتقنيات الجينية الجزيئية التقليدية مثل الرحلان الكهربائي لهلام الأغاروز الخالي من التسمية المشعة، وبالإضافة إلى ذلك، فإن هذه الطريقة تنتج نتائج واضحة ويمكن تمييزها بسهولة ومحددة. كان الهدف من تطبيق LIDSIP هو رسم خريطة عالمية لـ L1 النشط في الجينوم البشري عن طريق تضخيم نهاية المنطقة غير المترجمة 3'(UTR) للمجموعة الفرعية L1 - Ta حتى تسلسل التعرف على إنزيم التقييد المحدد التالي. أولاً، تم هضم 500 نانوغرام من الحمض النووي الجيني البشري باستخدام BstYI (مختبرات نيو إنجلاند البيولوجية، بيفرلي، ماساتشوستس، الولايات المتحدة الأمريكية) وتم تنقيتها باستخراج الفينول كلوروفورم وترسيب الإيثانول. ثانيًا، تم ربط الحمض النووي بـ 20 بيكو مول لكل من LIDSIP - LINK (5′- AGGTAACGAGTCAGACCACCGACTCGTGACGT -3 ′) و BstYI - LINK (5′-GATCACGTCACGAG -3 ′) باستخدام T4 DNA ligase (New England Biolabs) عند 16 درجة مئوية بين عشية وضحاها. أخيرًا، تم إخضاع 50 نانوغرام من الحمض النووي المنقى المربوط إلى تفاعل البوليميراز المتسلسل المتداخل. احتوى أول PCR (الحجم الإجمالي 50 ميكرولتر) على 200 ميكرومتر لكل من dNTPs الأربعة، 1× PCR buffer (يحتوي على 1.5 مللي مولار MgCl2 ؛ Qiagen، فالنسيا، كاليفورنيا، الولايات المتحدة الأمريكية)، 0.1 U HotStarTaq ® (Qiagen)، 0.4 ميكرومتر من L1 - ACA (5 ′-GAGATCTACCTAATGCTAGATGACA -3 ′) (1)، و 5′ linker (5′-AGGGTAACGAGTCAGACCACCGA -3 ′). تم إجراء تضخيم تفاعل البوليميراز المتسلسل على النحو التالي: التمديد الأولي عند 95 درجة مئوية لمدة 15 دقيقة، تليها 20 دورة من التمديد عند 95 درجة مئوية لمدة 45 ثانية، والتلدين عند 57 درجة مئوية لمدة 45 ثانية، والتمديد عند 72 درجة مئوية لمدة دقيقتين، والتمديد النهائي عند 72 درجة مئوية لمدة 7 دقائق. لتقسيم عدد أنواع المنتجات إلى مجموعات فرعية يمكن تمييزها عن طريق الرحلان الكهربائي، تم إجراء 20 دورة من تفاعل البوليميراز المتداخل باستخدام 32 بادئًا خيمريًا مختلفًا. تساعد هذه الخطوة على تجزئة المنتجات المتكررة المشابهة لـ MseI 3+ primers في تعدد أشكال التضخيم الخاص بالتسلسل (S - SAP)، والذي تم تطويره لعرض المنقولات الخلفية للنبات (8). يتكون كل تفاعل من 20 دورة تضخيم تحتوي على 1 ميكرولتر من منتج تفاعل البوليميراز المتسلسل الأولي، واحد من 32 بادئًا خيمريًا [5′- GACTCGTGACGTGATC (C/T) XX -3 ′، حيث كان (C/T) C أو T، و XX كان 2 bp من التسلسلات المختارة عشوائيًا ؛ على سبيل المثال، خيمري TGA هو 5′-GACTCGTGACGTGATCTGA -3 ′]، GCNP (1)، و التمهيدي المتداخل L1، GCGCACCAGCATGGCACA. ويتضح ذلك كذلك من خلال الرسم التخطيطي (الشكل 1) ومثال على LIDSIP (الشكل 2 أ)، على التوالي. عند مقارنة منتجات LIDSIP بين 14 فردًا تايلانديًا، يمكن تحديد 37 LIDs مرشحًا. في المتوسط، أنتج كل تفاعل تفاعل البوليميراز المتسلسل المتداخل 10 من إجمالي 300 منتج لكل عينة. تم اختيار خمسة LIDs مرشحة، واستنساخها إلى ناقل الاستنساخ السهل pGEM - T (Promega، Madison، WI، USA)، وتحويلها إلى الإشريكية القولونية DH5 α. تم إجراء تسلسل الحمض النووي على جهاز تسلسل الحمض النووي ABI 3100 (Applied Biosystems، Foster City، CA، USA)، وتم تحليل النتائج بواسطة برنامج أداة البحث عن المحاذاة المحلية الأساسية (BLAST) (www.ncbi.nih.gov/BLAST). كشفت جميع المستنسخات عن المنبع L1، وموقع التكامل، والنسخة الواحدة، وتسلسل التمهيدي الخيمري. ومع ذلك، كانت نتائج الانفجار خالية من L1 المنبع من التسلسل المجاور، وكانت مواقع ما قبل الاندماج فقط موجودة بالفعل في قاعدة بيانات الجينوم البشري (GenBank® access nos AC015547 at 86,101 bp, AC087307 at 13,330 bp, AL392087 at 11,869 bp, AL583842 at 37,981 bp, and AP001996 at 37,981 bp)، مما يشير إلى عمليات إعادة نقل حديثة. تم إجراء تفاعل البوليميراز المتسلسل للغطاء (1،2)، وتم تأكيد تعدد الأشكال لجميع العلامات (الشكل 2 ب). الشكل 1. تحديد الأشكال الثنائية للخط 1 بواسطة مخطط تفاعل البوليميراز المتسلسل (LIDSIP). تم ربط رابط تفاعل البوليميراز المتسلسل المعدل بوساطة الربط (LMPCR) (الخط الأسود) بالحمض النووي الجيني (الخط الرمادي) في موقع BstYI. يتم توضيح المجموعة الفرعية L1 - Ta على أنها مثلث أسود. تمثل الخطوط المتقطعة المنتجات الأولى والمتداخلة. الأسهم هي بادئات. L1 - ACA و GCNP هي 3'متواليات من L1. التمهيدي الرابط هو تسلسل 5'من الرابط. التمهيدي الخيمري هو تسلسل 3'من الرابط وموقع التقييد بالإضافة إلى تسلسل فريد عشوائي من اثنين من النيوكليوتيدات، كما هو موضح في X.Figure 2. تحديد ثنائيات الشكل الإدراجية LINE -1 بواسطة تفاعل البوليميراز المتسلسل (LIDSIP) وثنائيات الشكل الإدراجية LINE -1 (LID) PCR.(أ) منتجات LIDSIP من أربعة أفراد، الممرات 1–4. تم تحديد كل منها بواسطة اثنين من البرايمر الخيمري المختلف، TGA chimeric و TCG chimeric. تمت الإشارة إلى LIDs المرشحة في الأسهم. M هو سلم الحمض النووي M24 100 - bp + 1.5 كيلو بايت (SibEnzyme، نوفوسيبيرسك، روسيا). (ب) أظهر اثنان من تفاعل البوليميراز المتسلسل للغطاء تعدد الأشكال بين ستة أفراد مختلفين، الممرات 1–6. M هو سلم الحمض النووي M24 100 - bp + 1.5 كيلو بايت. أدى تطبيق LIDSIP إلى تحسين كل من البساطة والفعالية مقارنة بتقنيتي PCR السابقتين. تقوم الشاشة الأولى، L1 (1)، بفحص LIDs عن طريق تفاعل البوليميراز المتسلسل باستخدام بادئات تحكيمية، وتحليل البقعة الجنوبية، والتهجين لتحديد الهوية. ينتج عن كل تفاعل PCR عددًا محدودًا من المنتجات. لذلك، لتغطية الجينوم البشري بأكمله، تتطلب هذه التقنية كمية كبيرة من الحمض النووي وعدد من تفاعل البوليميراز المتسلسل. يطبق كل من ATLAS و LIDSIP نفس مبدأ تفاعل البوليميراز المتسلسل أحادي الموقع وينتج المزيد من التسلسلات اعتمادًا على مواقع إنزيم التقييد بجوار L1. نظرًا للعدد الكبير من القوالب متغيرة الحجم، مع ATLAS، يجب تسمية هذه المنتجات بـ ATP [γ -33P] المشع وفصلها عن طريق تغيير طبيعة الرحلان الكهربائي لهلام البولي أكريلاميد طويل المدى. مع LIDSIP، لا يلزم وضع العلامات المشعة، ويتم تسهيل استعادة الهلام بشكل كبير. وبالتالي، من خلال تقسيم منتجات L1 إلى عدة مجموعات فرعية مع تفاعل البوليميراز المتسلسل المتداخل باستخدام البرايمر الخيمري، يصبح تمايز الحجم عن طريق الرحلان الكهربائي لهلام الأغاروز ممكنًا. بالإضافة إلى ذلك، فإن LIDSIP قادر على الحد من استخدام الحمض النووي الأصلي بواسطة تفاعل البوليميراز المتسلسل المتداخل عند الحاجة إلى استعادة الغطاء. لن تؤدي بساطة LIDSIP إلى توسيع معدل الاكتشاف عالميًا فحسب، بل يمكن أيضًا تعديل المبدأ المنهجي لـ S - SAP لتحديد إدخالات الجينوم متعدد الأشكال للعناصر المتنقلة الأخرى (8). شكر وتقدير تم دعم هذه الدراسة من قبل برنامج الدكتوراه في اليوبيل الذهبي الملكي، ووحدة أبحاث البيولوجيا الجزيئية وعلم الوراثة لتطوير السرطان، وجامعة شولالونغكورن، وصناديق البحوث التايلاندية. نشكر السيدة بيترا هيرش على مراجعتها النقدية للمخطوطة .بيان المصالح المتنافسة يعلن المؤلفون عدم وجود تضارب في المصالح. المراجع1. شين، إف إم، إس تي شيري، جي إم ريش، إم روبيتشوكس، آي ناسيدزي، إم ستونكينج، إم إيه باتزر، وجي دي سويرغولد. 2000. القراءة بين الخطوط: التباين الجيني البشري الناجم عن النقل الرجعي للخط 1. الجينوم Res. 10: 1496-1508.Crossref، Medline، CAS، Google Scholar2. Badge, R.M., R.S. Alisch, and J.V. Moran. 2003. أطلس: نظام لتحديد الإدخالات L1 الخاصة بالبشر بشكل انتقائي. Am. J. Hum. Genet. 72: 823-838. كروسريف، ميدلاين، CAS، جوجل سكولار 3. سميت، A.F. 1999. تتكرر التكرارات المتداخلة والتذكارات الأخرى للعناصر القابلة للنقل في جينومات الثدييات. العملة. الرأي. المولد. التطوير. 9:657–663.Crossref, Medline, CAS, Google Scholar4. Kazazian, H.H., Jr., and J.V. Moran. 1998. تأثير الترانسبوزونات الخلفية L1 على الجينوم البشري. Nat. Genet. 19:19 -24.Crossref، Medline، CAS، Google Scholar5. Sassaman, D.M., B.A. Dombroski, J.V. Moran, M.L. Kimberland, T.P. Naas, R.J. DeBerardinis, A. Gabriel, G.D. Swergold, and H.H. Kazazian, Jr. 1997. العديد من عناصر L1 البشرية قادرة على النقل الرجعي. Nat. Genet. 16:37–43.Crossref، Medline، CAS، Google Scholar6. Mueller, P.R. and B. Wold. 1989. في البصمة الحية لمحسن معين للعضلات عن طريق ربط تفاعل البوليميراز المتسلسل بوساطة الارتباط. Science 246:780–786.Crossref, Medline, CAS, Google Scholar7. Nelson, D.L., S.A. Ledbetter, L. Corbo, M.F. Victoria, R. Ramirez - Solis, T.D. Webster, D.H. Ledbetter, and C.T. Caskey. 1989. تفاعل سلسلة البلمرة ALU: طريقة للعزل السريع للتسلسلات الخاصة بالإنسان من مصادر الحمض النووي المعقدة. بروك. ناتال. أكاد. ساينس الولايات المتحدة الأمريكية 86: 6686-6690.Crossref، Medline، CAS، Google Scholar8. Leigh, F., R. Kalendar, V. Lea, D. Lee, P. Donini, and A.H. Schulman. 2003. مقارنة فائدة عائلات الشعير المنقول للخلف للتحليل الجيني بواسطة تقنيات العلامات الجزيئية. Mol. Genomet. Genomics 269: 464-474.Crossref, Medline, CAS, Google ScholarFiguresReferencesRelatedDetailsCited ByOngoing endeavours to detect mobilization of transposable elementsBMB Reports, Vol. 55, No. 7Dynamic silting of somatic L1 retrotransposon insertions reflects the developmental contexts of their genomic integration10 May 2017 | Mobile DNA, Vol. 8, No. 1Intragenic long interspersed element -1 sequences promoter hypermethylation in lung adenocarcinoma, multiple myeloma and prostate cancer31 August 2012 | Genes & Genomics, Vol. 34, No. 5Human Transposon TectonicsCell, Vol. 149, رقم 4 يمكن للفيروسات القهقرية الذاتية المنشأ أن تؤدي إلى إنهاء النسخ قبل الأوان على مسافة 23 فبراير 2012 | أبحاث الجينوم، المجلد. 22، رقم 5 نقص ميثيل الخط 1 داخل الجين يكبح النسخ في الخلايا السرطانية من خلال AGO215 مارس 2011 | PLOS ONE، المجلد. 6، رقم 3 المجلد. 37، رقم 5 تابعنا على وسائل التواصل الاجتماعي للحصول على آخر التحديثات المقاييس التي تم تنزيلها 368 مرة التاريخ المستلم 3 يونيو 2004 مقبول 28 يونيو 2004 منشور على الإنترنت 6 يونيو 2018 منشور في نسخة مطبوعة نوفمبر 2004 معلومات© 2004 المؤلف(المؤلفون) شكر وتقدير تم دعم هذه الدراسة من قبل برنامج دكتوراه اليوبيل الذهبي الملكي، البيولوجيا الجزيئية و وحدة أبحاث علم الوراثة لتطوير السرطان، جامعة شولالونغكورن، وصناديق البحوث التايلاندية. نشكر السيدة بيترا هيرش على مراجعتها النقدية للمخطوطة. بيان المصالح المتنافسة يعلن المؤلفون عدم وجود تضارب في المصالح. تنزيل ملف PDF