The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.