Powered by OpenAIRE graph
Found an issue? Give us feedback
image/svg+xml Jakob Voss, based on art designer at PLoS, modified by Wikipedia users Nina and Beao Closed Access logo, derived from PLoS Open Access logo. This version with transparent background. http://commons.wikimedia.org/wiki/File:Closed_Access_logo_transparent.svg Jakob Voss, based on art designer at PLoS, modified by Wikipedia users Nina and Beao Mammalian Genomearrow_drop_down
image/svg+xml Jakob Voss, based on art designer at PLoS, modified by Wikipedia users Nina and Beao Closed Access logo, derived from PLoS Open Access logo. This version with transparent background. http://commons.wikimedia.org/wiki/File:Closed_Access_logo_transparent.svg Jakob Voss, based on art designer at PLoS, modified by Wikipedia users Nina and Beao
Mammalian Genome
Article . 1994 . Peer-reviewed
License: Springer TDM
Data sources: Crossref
image/svg+xml Jakob Voss, based on art designer at PLoS, modified by Wikipedia users Nina and Beao Closed Access logo, derived from PLoS Open Access logo. This version with transparent background. http://commons.wikimedia.org/wiki/File:Closed_Access_logo_transparent.svg Jakob Voss, based on art designer at PLoS, modified by Wikipedia users Nina and Beao
Hal
Article . 1994
Data sources: Hal
image/svg+xml Jakob Voss, based on art designer at PLoS, modified by Wikipedia users Nina and Beao Closed Access logo, derived from PLoS Open Access logo. This version with transparent background. http://commons.wikimedia.org/wiki/File:Closed_Access_logo_transparent.svg Jakob Voss, based on art designer at PLoS, modified by Wikipedia users Nina and Beao
HAL INRAE
Article . 1994
Data sources: HAL INRAE
Mammalian Genome
Article . 1995
versions View all 4 versions
addClaim

Sequence evolution of SRY gene within Bovidae family

Authors: Payen, E.J.; Cotinot, C.Y.;

Sequence evolution of SRY gene within Bovidae family

Abstract

In mammals, male sex determination requires a dominant factor provided by the Y Chromosome (Chr). The SRY gene corresponds to this key factor (Sinclair et al. 1990) and is conserved in mammalian species (Foster et al. 1992). The predicted amino acid sequence of SRY contains a central "high mobility group" domain (HMG-box) characteristic of a wide variety of DNA-binding proteins (Nasrin et al. 1991). This conserved motif represents a functional protein domain necessary for DNA-binding activity of SRY, and mutations in this area are responsible for sex inversion (Harley et al. 1992). In contrast, no function has been assigned to terminal regions of the SRY protein which are poorly conserved between species (Whitfield et al. 1993; Tucker and Lundrigan 1993). Here, we investigated sequence evolution for the coding region of the SRY gene in ruminants (family Bovidae), and we compared the divergences inside two subfamilies: Bovinae and Caprinae. In previous work we cloned the HMG-box region of the sheep, cattle, and goat SRY gene (Payen and Cotinot 1993). Using 5'-RACE from sheep testicular RNA, we isolated a 400-bp fragment that hybridizes specifically with SRY. This fragment was used to screen a male sheep genomic library, and an insert of 12 kb containing the sheep SRY gene was obtained and partially sequenced. From this sequence, oligonucleotide primers flanking the open reading frame (ORF) were defined to amplify genomic DNA from males and females of the Bovidae family. The PCR conditions were: 30 cycles of 94~ for 1 min, 52~ for 1 min, 72~ for 1 min with Taq polymerase (Cetus) and forward (5' T G C C A G G A G G T A T T G A G G G G 3') and reverse primers (5' CAGAGGAGCAGTTATTTTGG 3'). The resulting male specific amplified fragments were cloned in the pBluescript vector KS + and sequenced. The sequences of four investigated species are available under the following accession numbers: Z30265 (sheep), Z30646 (goat), Z30327 (cattle), Z30321 (bison) [EMBL data bank]. The two members of the Caprinae subfamily (sheep and goat) possess the longest ORF: 723 bp against 690 bp for Bovinae. The length difference results in the position of the first ATG. Within the same subfamily, the homology per-

Country
France
Keywords

Sheep, Base Sequence, Bison, [SDV]Life Sciences [q-bio], Goats, Molecular Sequence Data, Nuclear Proteins, SEQUENCE PROTEIQUE, Ruminants, Sex-Determining Region Y Protein, [SDV] Life Sciences [q-bio], DNA-Binding Proteins, Genes, Species Specificity, Animals, Cattle, Amino Acid Sequence, Sequence Alignment, Phylogeny, Transcription Factors

  • BIP!
    Impact byBIP!
    selected citations
    These citations are derived from selected sources.
    This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    32
    popularity
    This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
    Average
    influence
    This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    Top 10%
    impulse
    This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
    Top 10%
Powered by OpenAIRE graph
Found an issue? Give us feedback
selected citations
These citations are derived from selected sources.
This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Citations provided by BIP!
popularity
This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
BIP!Popularity provided by BIP!
influence
This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Influence provided by BIP!
impulse
This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
BIP!Impulse provided by BIP!
32
Average
Top 10%
Top 10%
Related to Research communities
INRAE
Upload OA version
Are you the author of this publication? Upload your Open Access version to Zenodo!
It’s fast and easy, just two clicks!