In mammals, male sex determination requires a dominant factor provided by the Y Chromosome (Chr). The SRY gene corresponds to this key factor (Sinclair et al. 1990) and is conserved in mammalian species (Foster et al. 1992). The predicted amino acid sequence of SRY contains a central "high mobility group" domain (HMG-box) characteristic of a wide variety of DNA-binding proteins (Nasrin et al. 1991). This conserved motif represents a functional protein domain necessary for DNA-binding activity of SRY, and mutations in this area are responsible for sex inversion (Harley et al. 1992). In contrast, no function has been assigned to terminal regions of the SRY protein which are poorly conserved between species (Whitfield et al. 1993; Tucker and Lundrigan 1993). Here, we investigated sequence evolution for the coding region of the SRY gene in ruminants (family Bovidae), and we compared the divergences inside two subfamilies: Bovinae and Caprinae. In previous work we cloned the HMG-box region of the sheep, cattle, and goat SRY gene (Payen and Cotinot 1993). Using 5'-RACE from sheep testicular RNA, we isolated a 400-bp fragment that hybridizes specifically with SRY. This fragment was used to screen a male sheep genomic library, and an insert of 12 kb containing the sheep SRY gene was obtained and partially sequenced. From this sequence, oligonucleotide primers flanking the open reading frame (ORF) were defined to amplify genomic DNA from males and females of the Bovidae family. The PCR conditions were: 30 cycles of 94~ for 1 min, 52~ for 1 min, 72~ for 1 min with Taq polymerase (Cetus) and forward (5' T G C C A G G A G G T A T T G A G G G G 3') and reverse primers (5' CAGAGGAGCAGTTATTTTGG 3'). The resulting male specific amplified fragments were cloned in the pBluescript vector KS + and sequenced. The sequences of four investigated species are available under the following accession numbers: Z30265 (sheep), Z30646 (goat), Z30327 (cattle), Z30321 (bison) [EMBL data bank]. The two members of the Caprinae subfamily (sheep and goat) possess the longest ORF: 723 bp against 690 bp for Bovinae. The length difference results in the position of the first ATG. Within the same subfamily, the homology per-