rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022 and supplemented with the FishCARD sequences from https://doi.org/10.5281/zenodo.4315277 . Primer Name: MiFish Universal Gene: 12S Length of Target: 163–185 get_seeds_local() minimum length: 170 get_seeds_local() maximum length: 250 blast_seeds() minimum length: 140 blast_seeds() maximum length: 250 max_to_blast: 1000 Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. https://doi.org/10.1098/rsos.150088 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.