rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name: Fungal_ITS gITS7/ITS4 Gene: FITS Length of Target: 150-330 get_seeds_local() minimum length: 105 get_seeds_local() maximum length: 500 blast_seeds() minimum length: 65 blast_seeds() maximum length: 461 max_to_blast: 100 Forward Sequence (5'-3'): GTGARTCATCGARTCTTTG Reverse Sequence (5'-3'): TCCTCCGCTTATTGATATGC Reference: White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, 18(1), 315–322. Ihrmark, K., Bödeker, I., Cruz-Martinez, K., Friberg, H., Kubartova, A., Schenck, J., Strid, Y., Stenlid, J., Brandström-Durling, M., & Clemmensen, K. E. (2012). New primers to amplify the fungal ITS2 region–evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiology Ecology, 82(3), 666–677. https://doi.org/10.1111/j.1574-6941.2012.01437.x We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.