rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name: rbcl (Plant RBCL7/8) Gene: rbcl Length of Target: 180 get_seeds_local() minimum length: 170 get_seeds_local() maximum length: 250 blast_seeds() minimum length: 140 blast_seeds() maximum length: 150 max_to_blast: 100 Forward Sequence (5'-3'): CTCCTGAMTAYGAAACCAAAGA Reverse Sequence (5'-3'): GTAGCAGCGCCCTTTGTAAC Reference: McFrederick, Q. S., and S. M. Rehan (2016). Characterization of pollen and bacterial community composition in brood provisions of a small carpenter bee. Molecular Ecology 25:2302–2311. https://doi.org/10.1111/mec.13608 & Spence, A. R., Wilson Rankin, E. E., & Tingley, M. W. (2022). DNA metabarcoding reveals broadly overlapping diets in three sympatric North American hummingbirds. The Auk, 139(1), ukab074. http://dx.doi.org/10.1093/auk/uky003 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.