rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name: Ford Fish 16S Gene: 16S Length of Target: 330 get_seeds_local() minimum length: 279 get_seeds_local() maximum length: 477 blast_seeds() minimum length: 231 blast_seeds() maximum length: 429 max_to_blast: 1000 Forward Sequence (5'-3'): GCAATCACTTGTCTTTTAAATGAAGACC, GTAATCACTTGTCTTTTAAATGAAGACC Reverse Sequence (5'-3'): GGATTGCGCTGTTATCCCTA Reference: Ford MJ, Hempelmann J, Hanson MB, Ayres KL, Baird RW, et al. (2016) Estimation of a Killer Whale (Orcinus orca) Population’s Diet Using Sequencing Analysis of DNA from Feces. PLOS ONE 11(1): e0144956. https://doi.org/10.1371/journal.pone.0144956 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.