Supplementary Figure 1. Surface expression of c-Met and PD-L1 was detected

Supplementary Figure 1. Surface expression of c-Met and PD-L1 was detected. The expression of c-Met or PD-L1 on various HCC cell lines, human LO2 hepatocytes and the human carcinoma cell line A431 were detected by flow cytometry (A) and western blot analysis (B). The gene sequence of siRNAs targeting human c-Met are as follows: Si c-Met-1: AAACTAGAGTTCTCCTTGGAA and Si c-Met-2: AATTAGTTCGCTACGATGCAA.

Impact byBIP!

	selected citations These citations are derived from selected sources. This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).	0
	popularity This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.	Average
	influence This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).	Average
	impulse This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.	Average