Table 1 in New genus and species of Philippine spittlebug (Cercopidae: Hemiptera), with notes on subtribal placement of Trigonoschema
Table 1 in New genus and species of Philippine spittlebug (Cercopidae: Hemiptera), with notes on subtribal placement of Trigonoschema
Table 1. Primers used for amplifying and sequencing the molecular markers.PrimersSequenceReferencesMitochondrial coding genesCOILCO1490-JJCHACWAAYCATAAAGATATYGGAstrin & Stüben 2008HCO2198-JJAWACTTCVGGRTGVCCAAARAATCAAstrin & Stüben 2008Ron (F)GGATCACCTGATATAGCATTCCCSimon et al. 1994MidR (R)AATATRTGRTGDGCYCAWACHACryan & Svenson 2010Nuclear ribosomal genes18Sa2.0 (F)ATGGTTGCAAAGCTGAAACWhiting et al. 19979R (R)GATCCTTCCGCAGGTTCACCTACWhiting 200228SEE (F)CCGCTAAGGAGTGTGTAAHillis & Dixon 1991; Cryan et al. 2000MM (R)GAAGTTACGGATCTARTTTGHillis & Dixon 1991; Cryan et al. 2000Lalt (F)CCTCGGACCTTGAAAATCCDietrich et al. 2001Galt (R)TGTCTCCTTACAGTGCCAGADietrich et al. 2001V (F)GTAGCCAAATGCCTCGTCAHillis & Dixon 1991; Cryan et al. 2000X (R)CACAATGATAGGAAGAGCCHillis & Dixon 1991; Cryan et al. 2000Nuclear protein coding genesHistone 3HexAF (F)ATGGCTCGTACCAAGCAGACGGCColgan et al. (1998)HexAR (R)ATATCCTTGGGCATGATGGTGACColgan et al. (1998)