Powered by OpenAIRE graph
Found an issue? Give us feedback
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/ ZENODOarrow_drop_down
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/
ZENODO
Other literature type . 2026
License: CC 0
Data sources: ZENODO
ZENODO
Other literature type . 2026
License: CC 0
Data sources: Datacite
ZENODO
Other literature type . 2026
License: CC 0
Data sources: Datacite
versions View all 2 versions
addClaim

Meteorus desmiae Zitani 1998

Authors: Almeida, Luis Felipe Ventura De; Shaw, Scott Richard; Penteado-Dias, Angélica Maria; Hallwachs, Winnie; Janzen, Daniel H.;

Meteorus desmiae Zitani 1998

Abstract

Meteorus desmiae Zitani 1998 Diagnosis. Ocellus-ocular distance 0.50–0.90 × ocellar diameter, notauli usually shallow and not demarcated anteriorly, T2-T3 usually the same color as T4-T8. Molecular Data. BIN BOLD:AAB3999. COI-5P Sequence: CTGGTATATTGGGATTATCAATAAGTA TATTAATTCGTATAGAGTTATCAATACCGGGAAGGTTATTAGGGGATGACCAAATTTATAATAGAAT TGTCACTGCTCATGCATTTGTTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGTA ATTGATTAGTTCCTTTAATATTAGGGGCTCCTGATATAGCATTTCCTCGAATGAATAATATAAGATT TTGATTATTAATTCCTTCAATATTTATATTACTAATAAGAAGAATAATTAATATGGGAGTAGGAACA GGGTGAACTGTTTATCCTCCTTTATCATTAAATATAAGTCATGGGGGGATATCTGTAGATTTAGCTA TTTTTTCTTTACATTTAGCAGGAGCTTCTTCTATTATAGGGGCTGTTAATTTTATTACTACTATTATAA ATATACAATTAATAGGGTTAAAGTTAGATAATGTTACTTTATTTGTTTGATCAGTTTTAATTACTGCA ATTTTATTATTATTATCTTTACCTGTTTTAGCGGGGGCTATTACTATATTATTAACTGATCGAAATTTA AATACTTCTTTTTTTGATCCTGCTGGAGGGGGGGATCCTATTTTATATCAACATTTATTT. Comments. M. desmiae is very similar to M. mariamartachavarriae sp. nov. but can be recognized by its larger ocelli. Examined Material. 2 females DHJPAR0029326, DHJPAR0029324; 1 male DHJPAR0029325. Biology. M. desmiae is a solitary parasitoid that attacks Spilomelinae (Lepidoptera, Crambidae). Previously this species was recorded in ACG as a parasitoid of Desmia tages (Zitani et al. 1998), and also in Ecuador parasitizing an unidentified caterpillar, belonging to the superfamily Pyraloidea (Aguirre & Shaw 2014). Here M. desmiae was found to parasitize Desmia octomaculalis Amsel, 1956, Desmia ploralisDHJ02, Desmia ploralisDHJ03, Desmia ploralisDHJ09, Desmia Solis 19 and Trichaea pilicornis Herrich-Schäffer, 1866.

Published as part of Almeida, Luis Felipe Ventura De, Shaw, Scott Richard, Penteado-Dias, Angélica Maria, Hallwachs, Winnie & Janzen, Daniel H., 2026, Revision of the genus Meteorus Haliday from the Area de Conservacion Guanacaste, Costa Rica (Hymenoptera: Braconidae: Euphorinae: Meteorini), pp. 1-64 in Zootaxa 5767 (1) on page 23, DOI: 10.11646/zootaxa.5767.1.1, http://zenodo.org/record/19192739

Keywords

Braconidae, Insecta, Arthropoda, Meteorus, Animalia, Biodiversity, Hymenoptera, Taxonomy, Meteorus desmiae

  • BIP!
    Impact byBIP!
    selected citations
    These citations are derived from selected sources.
    This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    0
    popularity
    This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
    Average
    influence
    This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    Average
    impulse
    This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
    Average
Powered by OpenAIRE graph
Found an issue? Give us feedback
selected citations
These citations are derived from selected sources.
This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Citations provided by BIP!
popularity
This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
BIP!Popularity provided by BIP!
influence
This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Influence provided by BIP!
impulse
This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
BIP!Impulse provided by BIP!
0
Average
Average
Average