
Meteorus desmiae Zitani 1998 Diagnosis. Ocellus-ocular distance 0.50–0.90 × ocellar diameter, notauli usually shallow and not demarcated anteriorly, T2-T3 usually the same color as T4-T8. Molecular Data. BIN BOLD:AAB3999. COI-5P Sequence: CTGGTATATTGGGATTATCAATAAGTA TATTAATTCGTATAGAGTTATCAATACCGGGAAGGTTATTAGGGGATGACCAAATTTATAATAGAAT TGTCACTGCTCATGCATTTGTTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGTA ATTGATTAGTTCCTTTAATATTAGGGGCTCCTGATATAGCATTTCCTCGAATGAATAATATAAGATT TTGATTATTAATTCCTTCAATATTTATATTACTAATAAGAAGAATAATTAATATGGGAGTAGGAACA GGGTGAACTGTTTATCCTCCTTTATCATTAAATATAAGTCATGGGGGGATATCTGTAGATTTAGCTA TTTTTTCTTTACATTTAGCAGGAGCTTCTTCTATTATAGGGGCTGTTAATTTTATTACTACTATTATAA ATATACAATTAATAGGGTTAAAGTTAGATAATGTTACTTTATTTGTTTGATCAGTTTTAATTACTGCA ATTTTATTATTATTATCTTTACCTGTTTTAGCGGGGGCTATTACTATATTATTAACTGATCGAAATTTA AATACTTCTTTTTTTGATCCTGCTGGAGGGGGGGATCCTATTTTATATCAACATTTATTT. Comments. M. desmiae is very similar to M. mariamartachavarriae sp. nov. but can be recognized by its larger ocelli. Examined Material. 2 females DHJPAR0029326, DHJPAR0029324; 1 male DHJPAR0029325. Biology. M. desmiae is a solitary parasitoid that attacks Spilomelinae (Lepidoptera, Crambidae). Previously this species was recorded in ACG as a parasitoid of Desmia tages (Zitani et al. 1998), and also in Ecuador parasitizing an unidentified caterpillar, belonging to the superfamily Pyraloidea (Aguirre & Shaw 2014). Here M. desmiae was found to parasitize Desmia octomaculalis Amsel, 1956, Desmia ploralisDHJ02, Desmia ploralisDHJ03, Desmia ploralisDHJ09, Desmia Solis 19 and Trichaea pilicornis Herrich-Schäffer, 1866.
Published as part of Almeida, Luis Felipe Ventura De, Shaw, Scott Richard, Penteado-Dias, Angélica Maria, Hallwachs, Winnie & Janzen, Daniel H., 2026, Revision of the genus Meteorus Haliday from the Area de Conservacion Guanacaste, Costa Rica (Hymenoptera: Braconidae: Euphorinae: Meteorini), pp. 1-64 in Zootaxa 5767 (1) on page 23, DOI: 10.11646/zootaxa.5767.1.1, http://zenodo.org/record/19192739
Braconidae, Insecta, Arthropoda, Meteorus, Animalia, Biodiversity, Hymenoptera, Taxonomy, Meteorus desmiae
Braconidae, Insecta, Arthropoda, Meteorus, Animalia, Biodiversity, Hymenoptera, Taxonomy, Meteorus desmiae
| selected citations These citations are derived from selected sources. This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically). | 0 | |
| popularity This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network. | Average | |
| influence This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically). | Average | |
| impulse This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network. | Average |
