Table 2. PCR primers and conditions. GenePrimer SetPrimer Sequence′ (5 ′ –3 ′)Amplicon Size (bp)PCR ConditionsPrimer ReferencesLCOP-FAGAACWAAYCATAAAAYWATTGG65495 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 50 ◦ C 30 s and 72 ◦ C[54]HCO2198R C_LepFolFTAAACTTCAGGGTGACCAAAAAATCA ATTCAACCAATCATAAAGATATTGG658for 1 min; 72 ◦ C for 10 min 94 ◦ C for 1 min, 5 cycles of 94 ◦ C for 30 s, 45–50 ◦ C for 40 s, 72 ◦ C for 1 min, 30–35 cycles of 94 ◦ C[58]for 30 s, 51–54 ◦ C for 40 s and 72 ◦ CCOIC_LepFolR LCO1490FTAAACTTCTGGATGTCCAAAAAATCA GGTCAACAAATCATAAAGATATTGG654for 1 min, 72 ◦ C for 10 min 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 51 ◦ C 30 s and 72 ◦ C[58]HCO2198R VpmCOIF2TAAACTTCAGGGTGACCAAAAAATCA TACCTYTGAATTTGCAATTC646for 1 min; 72 ◦ C for 10 min 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 46 ◦ C 30 s and 72 ◦ C[59]VpmCOIR4AATAARTGTTGGTATAARATAGGfor 1 min; 72 ◦ C for 10 minCytbfTGAGGNCAAATATCHTTYTGA39395 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 53 ◦ C 30 s and 72 ◦ C[16, 49]CytbCytbr CytbnewF2 CytbnewR CytbnewF1GCAAATARRAARTATCATTCDG TGATTATGRGGAGGDTTYGC GTTGAATATGDATDGGDGTWAC TATGAGGAGGDTTYGCWGTTG330 248for 1 min; 72 ◦ C for 10 min 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 53 ◦ C 30 s and 72 ◦ C for 1 min; 72 ◦ C for 10 min 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 53 ◦ C 30 s and 72 ◦ CThis study This studyCytbnewRGTTGAATATGDATDGGDGTWACfor 1 min; 72 ◦ C for 10 min

Published as part of Pramatarova, Monika, Burckhardt, Daniel, Malenovský, Igor, Gjonov, Ilia, Schuler, Hannes & Štarhová Serbina, Liliya, 2024, Unravelling the Molecular Identity of Bulgarian Jumping Plant Lice of the Family Aphalaridae (Hemiptera: Psylloidea), pp. 11 in Insects 15 (9) on page 11, DOI: 10.3390/insects15090683, http://zenodo.org/record/15085268