TABLE 1 in What was known as Rhyothemis variegata (Linnaeus, 1763) and R. phyllis (Sulzer, 1776) (Odonata, Libellulidae) are the same species

TABLE 1. Primers used for PCR and sequencing in the present study. gene/markerprimer namesequence (5’ to 3’)referencehistone H3–H4 regionHex_ARATATCCTTGGGCATGATGGTGACMglinets et al. 2025histone H3–H4 regionLH4_2RTTAACCGCCGAAACCGTACAGGGTMglinets et al. 2025COI911TTTCTACAAATCATAAAGATATTGGFolmer et al. 1994COI912TAAACTTCAGGGTGACCAAAAAATCFolmer et al. 1994

Published as part of Kosterin, Oleg E., Vshivtseva, Ekaterina I. & Blinov, Alexander G., 2025, What was known as Rhyothemis variegata (Linnaeus, 1763) and R. phyllis (Sulzer, 1776) (Odonata, Libellulidae) are the same species, pp. 571 in Zootaxa 5725 (4) on page 571, DOI: 10.11646/zootaxa.5725.4.7, http://zenodo.org/record/17870208

Keywords

Biodiversity, Taxonomy

Impact byBIP!

	selected citations These citations are derived from selected sources. This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).	0
	popularity This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.	Average
	influence This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).	Average
	impulse This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.	Average

Found an issue? Give us feedback

0

Average