Powered by OpenAIRE graph
Found an issue? Give us feedback
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/ ZENODOarrow_drop_down
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/
ZENODO
Dataset . 2020
Data sources: ZENODO
ZENODO
Dataset . 2020
Data sources: Datacite
ZENODO
Dataset . 2020
Data sources: Datacite
versions View all 2 versions
addClaim

Table 2 in Discovery of Cytospora species associated with canker disease of tree hosts from Mount Dongling of China

Authors: Zhu, Haiyan; Pan, Meng; Bezerra, Jadson D. P.; Tian, Chengming; Fan, Xinlei;

Table 2 in Discovery of Cytospora species associated with canker disease of tree hosts from Mount Dongling of China

Abstract

Table 2. Genes used in this study with PCR primers, primer DNA sequence, optimal annealing temperature and corresponding references. LocusDefinitionPrimersPrimer DNA sequence (5'-3')Optimal annealing temp (°C)References of primers usedITSinternal transcribed spacer of ribosomal RNAITS1TCCGTAGGTGAACCTGCGG51White et al. 1990ITS4TCCTCCGCTTTTGATATGCLSUlarge subunit of ribosomal RNALRORACCCGCTGAACTTAAGC55Vilgalys and Hester 1990LR7TACTACCACCAAGATCTactactinACT-512FATGTGCAAGGCCGGTTTCGC61Carbone and Kohn 1999ACT-783RTACGAGTCCTTCTGGCCCATrpb2RNA polymerase II second largest subunitRPB2-5FGA(T/C)GA(T/C)(A/C)G(A/T)GATCA(T/C)TT(T/C)GG52Liu et al. 1999RPB2-7cRCCCAT(A/G)GCTTG(T/C)TT(A/G)CCCATtef-1αtranslation elongation factor 1-alphaEF1-668FCGGTCACTTGATCTACAAGTGC55Alves et al. 2008EF1-1251RCCTCGAACTCACCAGTACCGtub2beta-tubulinBt2aGGTAACCAAATCGGTGCTGCTTTG55Glass and Donaldson 1995Bt2bACCCTCAGTGTAGTGACCCTTGGC

Published as part of Zhu, Haiyan, Pan, Meng, Bezerra, Jadson D. P., Tian, Chengming & Fan, Xinlei, 2020, Discovery of Cytospora species associated with canker disease of tree hosts from Mount Dongling of China, pp. 97 in MycoKeys 62 on page 97, DOI: 10.3897/mycokeys.62.47854

Keywords

Biodiversity, Taxonomy

  • BIP!
    Impact byBIP!
    selected citations
    These citations are derived from selected sources.
    This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    0
    popularity
    This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
    Average
    influence
    This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    Average
    impulse
    This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
    Average
Powered by OpenAIRE graph
Found an issue? Give us feedback
selected citations
These citations are derived from selected sources.
This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Citations provided by BIP!
popularity
This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
BIP!Popularity provided by BIP!
influence
This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Influence provided by BIP!
impulse
This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
BIP!Impulse provided by BIP!
0
Average
Average
Average