
Table 2. Genes used in this study with PCR primers, primer DNA sequence, optimal annealing temperature and corresponding references. LocusDefinitionPrimersPrimer DNA sequence (5'-3')Optimal annealing temp (°C)References of primers usedITSinternal transcribed spacer of ribosomal RNAITS1TCCGTAGGTGAACCTGCGG51White et al. 1990ITS4TCCTCCGCTTTTGATATGCLSUlarge subunit of ribosomal RNALRORACCCGCTGAACTTAAGC55Vilgalys and Hester 1990LR7TACTACCACCAAGATCTactactinACT-512FATGTGCAAGGCCGGTTTCGC61Carbone and Kohn 1999ACT-783RTACGAGTCCTTCTGGCCCATrpb2RNA polymerase II second largest subunitRPB2-5FGA(T/C)GA(T/C)(A/C)G(A/T)GATCA(T/C)TT(T/C)GG52Liu et al. 1999RPB2-7cRCCCAT(A/G)GCTTG(T/C)TT(A/G)CCCATtef-1αtranslation elongation factor 1-alphaEF1-668FCGGTCACTTGATCTACAAGTGC55Alves et al. 2008EF1-1251RCCTCGAACTCACCAGTACCGtub2beta-tubulinBt2aGGTAACCAAATCGGTGCTGCTTTG55Glass and Donaldson 1995Bt2bACCCTCAGTGTAGTGACCCTTGGC
Published as part of Zhu, Haiyan, Pan, Meng, Bezerra, Jadson D. P., Tian, Chengming & Fan, Xinlei, 2020, Discovery of Cytospora species associated with canker disease of tree hosts from Mount Dongling of China, pp. 97 in MycoKeys 62 on page 97, DOI: 10.3897/mycokeys.62.47854
Biodiversity, Taxonomy
Biodiversity, Taxonomy
| selected citations These citations are derived from selected sources. This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically). | 0 | |
| popularity This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network. | Average | |
| influence This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically). | Average | |
| impulse This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network. | Average |
