Powered by OpenAIRE graph
Found an issue? Give us feedback
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/ ZENODOarrow_drop_down
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/
ZENODO
Dataset . 2025
License: CC BY
Data sources: ZENODO
ZENODO
Dataset . 2025
License: CC BY
Data sources: Datacite
ZENODO
Dataset . 2025
License: CC BY
Data sources: Datacite
 View all 2 versions
Claim

Nanopore contamination search results

Research datakeyboard_double_arrow_right Dataset 20 Oct 2025Publisher:Zenodo
Authors: Beeloo, Rick;

doi: 10.5281/zenodo.17396505 , 10.5281/zenodo.17396504

Nanopore contamination search results

Abstract

We searched the NCBI core nt database (810GB) for Nanopore sequence contamination. Rapid barcoding (rapid_ncbi_search_filtered.tsv) We searched for 5' - GCTTGGGTGTTTAACC - barcode - GTTTTCGCATTTATCGTGAAACGCTTTCGCGTTTTTCGTGCGCCGCTTCA - 3', replacing "barcode" with all 96 barcodes. The entire sequence was allowed to match with at most 20 edits and the barcode had to match with <=4 edits.Native barcoding (native_ncbi_search_filtered_strict.tsv) We searched for 5' - AAGGTTAA - barcode - CAGCACCT - 3' and sequence: 5' - GGTGCTG - barcode - TTAACCTTAGCAAT - 3' with all 96 barcodes. The entire sequence had to match with at most 4 edits, and so did the barcode. This is more stringent than rapid barcoding searches as the flanks are much shorter.

Related Organizations
  • BIP!
    Impact byBIP!
    selected citations
    These citations are derived from selected sources.
    This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    		 0
    popularity
    This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
    		 Average
    influence
    This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    		 Average
    impulse
    This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
    		 Average
Powered by OpenAIRE graph
Found an issue? Give us feedback
selected citations
These citations are derived from selected sources.
This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Citations provided by BIP!
popularity
This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
BIP!Popularity provided by BIP!
influence
This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Influence provided by BIP!
impulse
This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
BIP!Impulse provided by BIP!
0
Average
Average
Average
Related to Research communities
Netherlands Research Portal