Lectotype designation for Antigonus ruptifasciata Plötz, 1884 Antigonus ruptifasciata Plötz, 1884 was described from an unstated number of specimens from “South America” (Plötz 1884) and is currently treated as a valid species of the genus Timochares Godman & Salvin, 1896 (type species Leucochitonea trifasciata Hewitson, 1868) (Mielke 2005). In Latin, ruptus means broken, torn, or severed, and fascia means band or stripe. The original description and the name indicate that A. ruptifasciata has bands broken into spots in contrast to Timochares trifasciata (Hewitson, 1868) (type locality in Bolivia, as indicated on the label of the lectotype). To our knowledge, this species has not been recorded from South America (Evans 1953), and therefore the type locality is questionable. To deduce its possible type locality by genomic comparison, we searched for syntypes of A. ruptifasciata. One syntype, from the Weymer collection, now in MFNB, was found (Fig. 41a). According to its labels, it was identified by Plötz as ruptifasciata before publication of the name (the name was given as “i l” for “in litteris”), and one of the identification labels is in Plötz’s handwriting. The specimen lacks any indication of its provenance, which may explain a vague “South America” as the type locality, possibly Plötz’s or Weymer’s guess. Although this specimen does not bear a label to explicitly indicate that it is a type specimen, it agrees with the original description and was studied and identified by Plötz before publication, and, therefore, it is a syntype. Moreover, the syntype also agrees with the illustration of A. ruptifasciata in Draudt (1923), which shows a pale specimen with large and distinct brown spots arranged into irregular bands (reproduced here as Fig. 41b). This illustration is a likely copy of Plötz’s unpublished and presumably lost drawing t.[afel] 1019 (Plötz 1884). We have not found any other credible syntypes of A. ruptifasciata and it is possible that no others existed. Nevertheless, we follow the ICZN Code Recommendation 73F (ICZN 1999) avoiding the assumption of the holotype and considering any type specimens of A. ruptifasciata to be syntypes. To stabilize nomenclature and define the name A. ruptifasciata objectively, N.V.G. hereby designates the sequenced syntype, a female in the MFNB collection that bears the following seven white rectangular labels (1 st and last printed, others handwritten): [Coll. Weymer], [Ruptofasciata Plötz | no 43 best. v. Plötz], [Trifasc.Hew.ist die | binden im Hfl mehr gerade], [Antigonus (682-83.) | Ruptofasciata Pl.], [Ruptifasciata | Plötz i l], [56:2.], and [DNA sample ID: | NVG-21115G04 | c/o Nick V. Grishin] as the lectotype of Antigonus ruptifasciata Plötz, 1884. The number 43 possibly refers to some specimen number in Weymer’s collection, maybe a sequential number of each specimen identified by Plötz in all Plötz’s identifications of Weymer’s specimens, like “43 rd specimen identified by Plötz”; best[immt]. v[on]. is for identified by; the 2 nd and 5 th labels are in Weymer's handwriting, and the 4 th label is in Plötz’s handwriting; the label 56:2 gives a genus number (56 - Timochares) and a species number (2 - ruptifasciatus) in the Mabille catalog (1903) that was used as a guide for arranging the Hesperiidae near the apex, right forewing in the middle, and right hindwing near the tornus. The COI barcode sequence of the lectotype, sample NVG-21115G04, GenBank PQ489711, 658 base pairs is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTCTAAGCCTTCTTATTCGAACTGAATTAGGAAATCCCGGATCATTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTCATTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCAGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTAATATTATTAATTTCTAGAAGAATCGTAGAAAATGGAGCCGGAACAGGATGAACAGTTTACCCCCCCCTCTCAGCTAATATTGC ACACCAAGGTTCTTCTGTGGACTTAGCTATTTTTTCCCTACATTTAGCAGGTATCTCCTCAATTCTTGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCC TTTGATCAAATACCCCTATTTGTCTGAGCTGTTGGTATTACAGCATTACTTTTATTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTCTAACTGATCGAAATCTTAATACAT CATTTTTTGATCCTGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT Genomic comparison places the lectotype with specimens from Jamaica and not with those from continental America (Fig. 40). Wing patterns (Fig. 41) agree with this conclusion: brown spots are larger and darker and stand out with more contrast from the pale ground color in the lectotype, more similar to Jamaican specimens. Therefore, the type locality of A. ruptifasciata becomes Jamaica.

Published as part of Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, pp. 1-63 in The Taxonomic Report of the International Lepidoptera Survey 12 (3) on pages 37-39