Powered by OpenAIRE graph
Found an issue? Give us feedback
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/ ZENODOarrow_drop_down
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/
ZENODO
Dataset . 2024
License: CC BY
Data sources: ZENODO
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/
ZENODO
Dataset . 2024
License: CC BY
Data sources: ZENODO
addClaim

This Research product is the result of merged Research products in OpenAIRE.

You have already added 0 works in your ORCID record related to the merged Research product.

Subsampled RBFOX2 eCLIP fastq files

Authors: Yee, Brian;

Subsampled RBFOX2 eCLIP fastq files

Abstract

RBFOX2 eCLIP fastq files, subsampled to 10% (about 2M reads) to be used for demo purposes. 2 replicates, each with IP and size-matched input control (4 files total). Adapter sequence to trim ("RiL19"): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Related Organizations
  • BIP!
    Impact byBIP!
    citations
    This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    0
    popularity
    This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
    Average
    influence
    This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    Average
    impulse
    This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
    Average
Powered by OpenAIRE graph
Found an issue? Give us feedback
citations
This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Citations provided by BIP!
popularity
This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
BIP!Popularity provided by BIP!
influence
This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Influence provided by BIP!
impulse
This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
BIP!Impulse provided by BIP!
0
Average
Average
Average