<script type="text/javascript">
<!--
document.write('<div id="oa_widget"></div>');
document.write('<script type="text/javascript" src="https://www.openaire.eu/index.php?option=com_openaire&view=widget&format=raw&projectId=undefined&type=result"></script>');
-->
</script>
RBFOX2 eCLIP fastq files, subsampled to 10% (about 2M reads) to be used for demo purposes. 2 replicates, each with IP and size-matched input control (4 files total). Adapter sequence to trim ("RiL19"): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
citations This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically). | 0 | |
popularity This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network. | Average | |
influence This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically). | Average | |
impulse This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network. | Average |