Euriphellus panamicus Grishin, new species https://zoobank.org/ F9D83659-187D-4AC5-8EAC-D1B5A599D972 (Fig. 1 part, 13–14, 225–226) Definition and diagnosis. Sister to previous species and differs from it by 1.8% (12 bp) in COI barcode. The previous species is either sympatric with this new species in Panama or comes close to it in distribution. Keys to “ Dyscophellus phraxanor phraxanor ” (D.4.2(b)) in Evans (1952) but differs from it and other relatives by a combination of more convex and wider tegumen in lateral view, terminally rounded and wider basal tooth of harpe (Fig. 226), ventral margin of harpe being even less shouldered than in E. panador new species (Fig. 224), well-defined hindwing discal spots, not hyaline (could be pale-centered), spot in cell M 2 -M 3 nearly within the row, comparatively (to the ventral hindwing discal yellow spots) smaller forewing subapical spots, and stronger orange overscaling in the anterior part of ventral forewing (Fig. 13–14). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly671.39.2:T432C, aly887.9.1:G232A, aly102.20.9:G45T, aly272.9.2:G61A, aly272.9.2:G79A, aly 2578.3.9:G222G (not T), aly 2578.3.9:A230A (not G), aly2275.23.9:A72A (not G), aly4036.9.5:G321G (not A), aly27.16.1:T1497T (not C), and COI barcode: T118C, A181A, A202G, T376G, A625G. Barcode sequence of the holotype. Sample NVG-17104C10, GenBank OR837626, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATGTTAGGAACTTCTTTAAGTTTACTAATTCGAACTGAATTAGGAACTCCAGGATCTTTAATT GGAAATGATCAAATTTATAACACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTCGGAAACT GATTAGTGCCATTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAATAAACAATATAAGATTTTGATTACTTCCCCCTTCTTTAATATTATTAAT TTCAAGAAGAATCGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTTTATCTGCTAATATTGCTCATCAAGGATCGTCAGTTGATTTA GCAATTTTTTCTCTTCACTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACGATTATTAATATACGAATTAGAAACTTATCTT TCGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTACTTCTCTCTTTACCTGTACTAGCAGGTGCAATTACTATATTATT AACAGACCGAAATTTTAATACATCTTTTTTTGATCCTTCTGGGGGAGGAGATCCTATTTTATACCAACATTTATTT Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 13–14, bears the following four rectangular labels, three white: [Cerro Jefe 2200’ | Pma., Panama | April 10, 1974 | G B Small], [DNA sample ID: | NVG-17104C10 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 00913859], and one red [HOLOTYPE ♂ | Euriphellus | panamicus Grishin]. Type locality. Panama: Panama Province, Cerro Jefe, elevation 2200′. Etymology. The name is given for the type locality and is a masculine adjective. Distribution. Currently known only from the type locality in central Panama.

Published as part of Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, pp. 1-115 in Insecta Mundi 2023 (26) on pages 9-10, DOI: 10.5281/zenodo.10396362