
4.7. Cloning and expression of K. brevis EH1 Contig MGID2034061 of a K. brevis EST library (Lidie et al., 2005) was synthesized (after optimization of codon usage for E. coli expression) and cloned into pUC 57 by Genescript. The insert was subcloned into pET30a+ vector for protein expression: Specific primers (Forward: CACAATCATATGCCGCTGACGGA, Reverse: AATAAGCTTTAATGATGATGATGATGATGCAGACGGCTCTGATTTTTAT) were designed to amplify the codon optimized K. brevis EH. Primers incorporated HindIII (reverse primer) and NdeI (forward primer) restriction sites for directional cloning and 6 histidine codons (reverse primer). The PCR product was ligated with pET30a+ using T4 DNA ligase (Invitrogen) according to the manufacturer’s instructions. The newly constructed plasmid was transformed into expression strain BL21(DE3) by electroporation. Recombinant cells were grown following manufacturer’s guide (Invitrogen). White colonies were picked and grown in LB broth with kanamycin (50 Lg/ml).Plasmids were extracted using QIAprep Spin Miniprep Kit (Qiagen) according to the manufacturer’s instruction and sent to Eurofins Genomics for sequencing to insure fidelity of insert sequence. The recombinant E. coli was inoculated into LB broth with kanamycin (50 Lg/ml) and shaken at 37 °C overnight. The overnight culture (5 ml) was diluted into fresh LB broth (500 ml) with kanamycin (50 Lg/ml), shaken at 37 °C (250 rpm for 2–3 h). IPTG (1 mM final concentration) was added when the OD 600 reached to 0.6–0.8. After shaking another 4–6 h, the culture was centrifuged (5000× g for 10 min). Lysozyme (2 Ll, 50 mg /ml) and DNAse I (2 Ll, 2500 unit/ ml) as well as Bacterial Protein Extraction reagent (B-PER, Thermal Scientific, 4 ml/ gram of cells) were added to resuspend the pellets. After incubation at room temperature for 10 min, the lysate was centrifuged (15000× g for 5 min) to separate insoluble proteins. The supernatant was loaded to a column of 1 ml Ni–NTA agarose (Qiagen). The column was washed (20 mM phosphate, 0.5 M NaCl, 20 mM imidazole, 10% glycerol, pH 7.9) until no more protein was eluted (as determined by A 280) in the wash (typically 10 ml). This was followed by elution buffer (10 ml, 20 mM phosphate, 0.5 M NaCl, 250 mM imidazole, 10% glycerol, pH 7.9). The purified EH was dialyzed (MW cutoff 12–14 kDa) in phosphate buffer (50 mM sodium phosphate, pH 7.0) at 0–4 °C, overnight, flash frozen in liquid N 2 and stored at –80 °C until use. Final protein concentrations ranged from 0.2 to 0.3 mg /ml.
Published as part of Sun, Pengfei, Leeson, Cristian, Zhi, Xiaoduo, Leng, Fenfei, Pierce, Richard H., Henry, Michael S. & Rein, Kathleen S., 2016, Characterization of an epoxide hydrolase from the Florida red tide dinoflagellate, Karenia brevis, pp. 11-21 in Phytochemistry 122 on page 19, DOI: 10.1016/j.phytochem.2015.11.002, http://zenodo.org/record/10485359
Hemiptera, Insecta, Arthropoda, Karenia, Karenia brevis, Animalia, Biodiversity, Taxonomy, Cicadidae
Hemiptera, Insecta, Arthropoda, Karenia, Karenia brevis, Animalia, Biodiversity, Taxonomy, Cicadidae
| selected citations These citations are derived from selected sources. This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically). | 0 | |
| popularity This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network. | Average | |
| influence This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically). | Average | |
| impulse This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network. | Average |
