The human gene locus H2AZ was assigned to chromosome 4 by challenging a panel of 27 human-hamster hybrid cell lines with oligonucleotide probes specific to two regions of the human gene. The human gene H2AZ locus has three EcoRI sites, yielding 2.9-kb upstream and 4.7-kb downstream fragments after digestion. Commercial Southern blots were obtained with EcoRI-digested DNA preparations from the 27 lines. An oligonucleotide probe, taagagaacgctagagggagctggtgttca, to intron 3 of the gene gave one human-specific band on these blots consistent in size with the expected 4.7-kb downstream EcoRI fragment; this band was mapped to chromosome 4 (2 hybrid lines with chromosome 4, 25 without it; 27 concordances, no discordances). A 5[prime] utr oligonucleotide probe, tgccttgcttgcttgagcttcagcggaatt, to the upstream 2.9-kb fragment yielded two bands on these Southern blots. The smaller band, consistent in size with the expected 2.9-kb EcoRI gene fragment, was also mapped to chromosome 4 (27 concordances, no discordances). The larger, approximately 6-kb band was mapped to chromosome 21 (7 hybrid lines with chromosome 21, 20 without it; 26 concordances, 1 discordance) and may result from a possible pseudogene. From these results, the human gene H2AZ is assigned to chromosome 4; a possible pseudogene is assigned to chromosome 21.more » Thus, the human gene H2AZ is not part of the clusters of human replication-lined histone genes that have been assigned to chromosome 1, 6 and 12.« less