Dyspessa ulgen Yakovlev, Shapoval, Ivonin, Knyazev & Kuftina, sp. nov. (Figs. 4 A–B) Type. Holotype. Male, sample ID—YK500, GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401259; NE Kazakhstan, Tarbagatai Mts. range, 6 km W Karabuirat Village, 1020 m, 47°21′N / 81°06′E, 02.06.2018, P. Gorbunov leg. (GenPr # 9, coll. Yakovlev / 2018), deposited in the Zoological Institute of the Russian Academy of Sciences (St. Petersburg). Paratypes: 12 females, field codes YK501 (Gen-Bank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401260), YK502, YK503, YK504, YK505, YK506, YK507, YK508, YK509, YK510, YK511, YK512, same data and locality (deposited in ZISP, MWM, and RYB private collection); 9 females, field codes YK513, YK514, YK515, YK516, YK517, YK518, YK519, YK520, YK521), Eastern Kazakhstan, Kalba Mts, 40 km NW Kokpekty, 49°00′N / 82°00′, 760 m, 19.06.2018, R. Yakovlev, V. Doroshkin, V. Rudoj & A. Naydenov leg. (in RYB private collection); 4 females, field codes YK522, YK523, YK524, YK525, Eastern Kazakhstan, Kalba Mts., 6 km NW Panteleymonovka vill., 1130 m, 49º12′N / 83º12′E, 14.06.2012, R. Yakovlev leg. (in RYB private collection); 1 female, field code YC051 (GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401262), Russia, Altai Republic, Kosh-Agach distr., 5 km E Tebeler, Yustyt river valley, 1800 m, 24‾ 25.06.2015, V. Ivonin leg. (private col-lection of Vadim Ivonin, Novosibirsk); 1 female, field code YC050 (GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401261) E Kazahstan, Kurchum distr., 26 km SE of Barsk-Batyr vill., 1800 m, 48°29′N / 84°07′, 20.06.2014, A. Volynkin, S. Titov leg. (in RYB private collection); 3 females, field codes YK701, YK702, YK703, Russia, Altai Krai, Loktevsky distr., Aley river valley, 1 km N of Ust’yanka vill., 51°09’47.6”N / 81°35’45.8”E, 330 m, 17– 18.05.2020, leg. A.E. Naydenov (in RYB private collection). Diagnosis. The new species is most similar to D. ulula (Fig. 4D), from which it differs by: - the dark wings (D. ulula is much paler, the basic background is yellowish, the pale spots are much more expressed); - the expressed stepped bending on the costal edge of the valve (in D. tristis (Fig. 5A) and D. saldaitisi (Fig. 5B) the finely serrated surface on the costal edge of the valve in medium third; in D. ulula (Fig. 5C), the costal edge of valve is smoothly rounded; in D. saissanica (Fig. 5D) the proximal end of the process on the costal edge of the valve is sharp; - the phallus strongly bent in the medium third (in D. ulula, the phallus is less curved). The new species also differs from D. saissanica, D. saldaitisi D. tristis, and D. ulula (Figs 4C, 4E, 4F,) by the well-expressed dark color of the wings. Genetically, the new species differs from most closely related D. ulula by at least 36 fixed nucleotide substitutions (p-distance is 5.5%) within the studied 658bp fragment of the mitochondrial COI gene. COI barcode sequence of the holotype, 658 base pairs. AACATTATATTTTATTTTTGGAATTTGATCCGGAATAGTAGGTACTTCCTTAAGTCTATTAATTC- GAGCTGAATTAGGAAATCCAGGATCTTTAATTGGTAATGATCAAATTTATAATACTATTGTGACAACT- CATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGGGGATTTGGTAATTGATTAG TGCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTACTCCCCCCTTCTT- TA A C C C T T T TA AT T T C TA G G A G TAT T G T T G A A A AT G G A G C T G G A A C A G G AT G A A C A G T T- TA C C C T C C C C TAT C C T C TA ATAT C G C T C AT G G T G G A A G T T C A G T C G AT C TA G C TAT T T T T T C T TTACACTTAGCAGGAATTTCTTCCATCTTAGGAGCAATTAATTTTATTACCACTATCATTAATATAC- GCCCCTATAATATATCATTCGATCAAATACCCCTTTTTGTTTGAGCAGTTGGAATTACCGCATTAT- TACTTTTACTATCTCTTCCAGTATTAGCGGGAGCTATCACTATATTATTAACAGATCGAAATTTAAA TACTTCATTTTTTGACCCTGCGGGAGGGGGAGATCCAATTTTATACCAACATTTATTT Description. Male. (Fig. 4A) Length of forewing 10 mm. Antenna bipectinate, equal to half of the forewing length, antenna crest 1.5 times of antenna rod diameter. Thorax and abdomen are densely covered with pale grey scales. Forewing grey with a poorly developed pale pattern of pale cream spots along the costal edge in the discal cell, and two spots in the cubital area (one at wing base, second in the discal area). Fringe mottled, dark at veins, pale between veins. Hindwing ground colour and hindwing fringe grey, unicolorous. Female (Fig. 4B). Length of forewing 9‾ 11 mm. Antenna bipectinate, equal to half of the forewing length, an-tenna crest 0.5 times of antenna rod diameter. Thorax and abdomen are densely covered with pale grey scales. Wing pattern resembles that of males. Female genitalia (Fig. 5F). Ovipositor long, papillae analis semicircular, anterior apophyses three times shorter than posterior apophyses, ostium aperture slit-shaped, narrow. Male genitalia (Fig. 5E). Uncus triangle, apically blunt; gnathos arms short, thick; gnathos small, poorly sclerotized; valve basally sclerotized, caudal end membranous, lanceolately narrowing, stepped bending on the costal edge of the valve (in medium third); transtilla process short, basally very wide, apically narrowing, apex semicircular; juxta tiny, with a pair of short rod-shaped lateral processes; saccus semicircular, robust; phallus equal to 3/4 of valve length, thin, apically narrowing, strongly bent in the medium third, vesica aperture in dorso-apical position, equal to 2/3 of phallus length, vesica without cornuti. Distribution. Kazakhstan (Eastern Kazakhstan Province), Russia (Altai Krai Province). Etymology. Ulgen’—demiurge, the supreme deity in shamanism of Altaians, Khakas, and Shors.

Published as part of Yakovlev, Roman V., Shapoval, Nazar A., Ivonin, Vadim V., Knyazev, Svyatoslav A., Kuftina, Galina N. & Masharskiy, Alexey E., 2020, A new species of Carpenter Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains, pp. 85-95 in Zootaxa 4896 (1) on pages 91-94, DOI: 10.11646/zootaxa.4896.1.3, http://zenodo.org/record/4359282