Perus (Perus) perus Grishin, new species http://zoobank.org/ 445F016E-851C-4B10-B4EC-2853F968CA89 (Figs. 101 part, 102, 103a–d) Definition and diagnosis. Genomic analysis of specimens identified as Perus (Perus) cordillerae (Lindsey, 1925) (type locality Peru: Lima, Matucana, holotype sequenced as NVG-22043E08) reveals that they partition into two clades genetically differentiated at the species level (Fig. 101); e.g., their Fst / Gmin /COI barcode differences are 0.36/0.01/1.4% (9 bp). One clade (Fig. 101 blue) contains the holotype of P. cordillerae, along with specimens from Ecuador, and corresponds to this species. The other clade with specimens from Peru represents a new species. This new species keys to “ Staphylus cordillerae ” (E.32.25) in Evans (1953) and was included by him in that taxon, but differs from it by a rounder, and more robust spiculate process (lobe-shaped) arising from the wider folded-over region of the valva near the ampulla (Fig. 103a, c)—this process is more elliptical in P. cordillerae and the folded-over region is narrower (Fig. 103e, j, k); a concave junction between the tegumen and the uncus in lateral view (Fig. 103a, c)—straighter in P. cordillerae (Fig. 103e, h); the central dark band on the dorsal forewing that is mostly uniformly colored, without a strongly developed pale bar in the discal cell within the band; more uniform and weaker at margins yellowish overscaling beneath; and a more weakly developed central pale spot on the ventral hindwing. Due to unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly671.23.3:C198T, aly1468.14.2:A42G, aly276561.5.1:T763A, aly276561.5.1:A1998T, aly6841.32.4: A777G; and COI barcode: A181G, A325T, 400T, T508A, T557C. Barcode sequence of the holotype. Sample NVG-7826, GenBank PV550046, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGATCAGGTATAGTAGGAACTTCTTTAAGTATACTTATTCGATCTGAATTAGGAACACCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAACTGATTAGTACCTCTTATATTAGGAGCTCCTGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCTCCATCCCTTACATTATTAATTTCTAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTATATCCCCCTTTATCAGCTAATATTGC CCATCAAGGTTCTTCTGTTGATTTAGCTATCTTCTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGGGCAATTAATTTTATTACTACTATTATTAATATACGAATTAACAATTTATCA TTTGATCAAATATCTTTATTTGTATGAGCAGTAGGAATTACAGCATTACTTTTATTATTATCCTTACCAGTTCTAGCTGGAGCTATTACTATACTTCTTACAGATCGTAATTTAAATACTT CTTTTTTTGACCCTGCAGGAGGAGGAGATCCTATCTTATATCAACATTTATTT Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 102a (genitalia in Fig. 103a, b), bears the following five printed rectangular labels, four white: [PERU, AM, 3 km | S Abra Chanchillo | 06° 49'S, 77° 57'W | 19.ix.99, 2150m | Robbins, Lamas, Ahrenholz], [DNA sample ID: | NVG-7826 | c/o Nick V. Grishin], [genitalia | NVG170206-11 | Nick V. Grishin], [USNMENT | {QR Code} | 01321666], and one red [HOLOTYPE ♂ | Perus (Perus) | perus Grishin]. Fringes of the holotype are rather evenly damaged, giving it a somewhat unusual appearance. Paratypes: 2♂♂ and 1♀ from Peru, La Libertad Region, Angasmarca, old [USNM]: 1♂ NVG-18058H06 (leg DNA extraction, sequenced), NVG-23121C11 (abdomen DNA extraction and dissection), USNMENT 01466752, genitalia NVG240817-74 (Figs. 102b, 103c, d); 1♂ NVG- 23121F 02; and 1♀ NVG-23121E12. Type locality. Peru: Amazonas, 3 km south of Abra Chanchillo, elevation 2150 m, GPS −6.817, −77.950. Etymology. For this new species from Peru, the name is tautonymous with the genus name and is treated as a masculine noun in apposition. Distribution. Currently known from the Andean region in northern Peru.

Published as part of Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, pp. 1-201 in The Taxonomic Report of the International Lepidoptera Survey 12 (5) on pages 139-142, DOI: 10.5281/zenodo.16642576