To depict the variability among strains 2 STRs viz., GT6 and TA11CA3 region were amplified. All PCR reactions were carried out in 50μl total volume with 100 pmol of each primer and approximately 20 ng of template DNA. PCR reactions were performed on a Master cycler gradient using the primers 5’CCTATCGATCTATGGCTTCC3’ (forward) and 5’CCCGTACTTTATCGGCTCTA3’ (reverse) for the STR region TA11CA3and 5’CTGATCATAGCCACCAGTGT3’ (forward) 5’GTTAGGTCGAGACCACACAA3’ for GT6 region [16]. Reaction conditions were as follows: initial denaturation for 2 min at 96°C, followed by 45 cycles of 1 min at 96°C, 1 min at 58°C for TA11CA3and 55°C for GT6 and 2 min at 72°C. A final elongation step of 10 min at 72°C was included. All PCR products were sequenced directly using the forward primer in ABI-3130 XL Genetic analyzer. All the PCR experiments were done on stored DNA samples.