
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.
Molecular Weight, Mycoplasma, Base Sequence, RNA, Ribosomal, Nucleic Acid Conformation
Molecular Weight, Mycoplasma, Base Sequence, RNA, Ribosomal, Nucleic Acid Conformation
| selected citations These citations are derived from selected sources. This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically). | 44 | |
| popularity This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network. | Average | |
| influence This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically). | Top 10% | |
| impulse This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network. | Top 10% |
