Powered by OpenAIRE graph
Found an issue? Give us feedback
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/ Nucleic Acids Resear...arrow_drop_down
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/
Nucleic Acids Research
Article . 1982 . Peer-reviewed
Data sources: Crossref
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/
Nucleic Acids Research
Article
Data sources: UnpayWall
image/svg+xml art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos Open Access logo, converted into svg, designed by PLoS. This version with transparent background. http://commons.wikimedia.org/wiki/File:Open_Access_logo_PLoS_white.svg art designer at PLoS, modified by Wikipedia users Nina, Beao, JakobVoss, and AnonMoos http://www.plos.org/
Nucleic Acids Research
Article . 1983
Data sources: Europe PubMed Central
https://dx.doi.org/10.1093/nar...
Article
Data sources: Microsoft Academic Graph
 View all 2 versions
Claim

Two thraustochytrid 5S ribosomal RNAs

descriptionPublicationkeyboard_double_arrow_right Article 01 Jan 1982 English Publisher:Oxford University Press (OUP)Journal:Nucleic Acids Research, volume 10, pages 8,307-8,310 (issn: 0305-1048, eissn: 1362-4962, Copyright policy )
Authors: R M, MacKay; W F, Doolittle;

doi: 10.1093/nar/10.24.8307

pmid: 7162992

pmc: PMC327087

Two thraustochytrid 5S ribosomal RNAs

Abstract

The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs.

Related Organizations
Keywords

Base Sequence, Species Specificity, RNA, Ribosomal, Fungi, Nucleic Acid Conformation

  • BIP!
    Impact byBIP!
    selected citations
    These citations are derived from selected sources.
    This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    		 7
    popularity
    This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
    		 Average
    influence
    This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    		 Average
    impulse
    This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
    		 Average
Powered by OpenAIRE graph
Found an issue? Give us feedback
selected citations
These citations are derived from selected sources.
This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Citations provided by BIP!
popularity
This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
BIP!Popularity provided by BIP!
influence
This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Influence provided by BIP!
impulse
This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
BIP!Impulse provided by BIP!
7
Average
Average
Average
gold