AbstractThe molecular basis of mammalian sperm capacitation, either in vivo in the female reproductive tract, or in vitro, is poorly understood. It is well known that sperm capacitation is associated with an increase in tyrosine phosphorylation of a subset of proteins. We resolved the phosphoproteins in the cell lysate of mouse sperm after capacitation by 2‐DE. One tyrosine‐phosphorylated 130‐kDa spot was trypsin‐digested, and six oligopeptide sequences were established from the MS data. These were confirmed in a CCCTC‐binding nuclear factor (CTCF), a widely expressed and highly conserved protein. Further, both an anti‐phosphotyrosine antibody and an anti‐CTCF antibody showed immunoreactivity to a 130‐kDa component in the immunoprecipitates obtained after incubation of the cell lysate from the capacitated sperm using another anti‐CTCF antibody. The data support the presence of a tyrosine‐phosphorylated CTCF in the capacitated sperm. Immunolocalization of the CTCF revealed fluorescent staining in the acrosome region in both capacitated and incapacitated sperm. The electrophoretic mobility shift assay, using a CTCF target sequence 5'‐GGCGGCGCCGCTAGGGGTCTCTCT‐3' found in the promoter of the amyloid β‐protein precursor, manifested that, relative to CTCF in the incapacitated sperm, the tyrosine‐phosphorylated protein in the capacitated sperm had stronger affinity to the CTCF target sequence.