AbstractDiepoxybutane (DEB) is the most potent active metabolite of the environmental chemical 1,3‐butadiene (BD). BD is a human carcinogen that exhibits multiorgan systems toxicity. Our previous studies demonstrated that the X‐C motif chemokine ligand 1 (XCL1) gene expression was upregulated 3.3‐fold in a p53‐dependent manner in TK6 lymphoblasts undergoing DEB‐induced apoptosis. The tumor‐suppressor p53 protein is a transcription factor that regulates a wide variety of cellular processes, including apoptosis, through its various target genes. Thus, the objective of this study was to determine whether XCL1 is a novel direct p53 transcriptional target gene and deduce its role in DEB‐induced toxicity in human lymphoblasts. We utilized the bioinformatics tool p53scan to search for known p53 consensus sequences within the XCL1 promoter region. The XCL1 gene promoter region was found to contain the p53 consensus sequences 5′‐AGACATGCCTAGACATGCCT‐3′ at three positions relative to the transcription start site (TSS). Furthermore, the XCL1 promoter region was found, through reporter gene assays, to be transactivated at least threefold by wild‐type p53 promoter in DEB‐exposed human lymphoblasts. Inactivation of the XCL1 promoter p53‐binding motif located at −2.579 kb relative to TSS reduced the transactivation function of p53 on this promoter in DEB‐exposed cells by 97%. Finally, knockdown of XCL1 messenger RNA with specific small interfering RNA inhibited DEB‐induced apoptosis in human lymphoblasts by 50%. These observations demonstrate, for the first time, that XCL1 is a novel DEB‐induced direct p53 transcriptional target gene that mediates apoptosis in DEB‐exposed human lymphoblasts.