AbstractMutations of the NF1 locus cause neurofibromatosis 1 (NF1), a clinically variable autosomal dominant disease. Expression of neurofibromin, the protein product of the NF1 gene, is regulated in a tissue‐ and developmentally‐specific fashion, but the basis for this regulation is not understood. We used phylogenetic footprinting and other bioinformatic methods to identify potential transcriptional regulatory regions in the 5′ upstream region and intron 1 of the NF1 gene from human, mouse, rat, and pufferfish. Three genomic segments that have equal or higher homology than the coding region were found in the NF1 5′ upstream region, and four more very highly homologous regions were found in intron 1. Five of these highly homologous regions are confidently predicted to contain transcription factor binding sites. One highly homologous segment in the 5′ upstream region spans the transcription start site and contains several potential transcription factor binding sites. This segment includes a novel 24‐bp sequence (acttccggtggggtgtcatggcgg) that lies 310–333 bp upstream of the translation initiation site. This sequence, which is identical in human, mouse, and rat and differs by only 1‐bp in Fugu, may contain the core promoter element for NF1 transcription. © 2005 Wiley‐Liss, Inc.