Powered by OpenAIRE graph
Found an issue? Give us feedback
addClaim

TABLE 1 in What was known as Rhyothemis variegata (Linnaeus, 1763) and R. phyllis (Sulzer, 1776) (Odonata, Libellulidae) are the same species

Authors: Kosterin, Oleg E.; Vshivtseva, Ekaterina I.; Blinov, Alexander G.;

TABLE 1 in What was known as Rhyothemis variegata (Linnaeus, 1763) and R. phyllis (Sulzer, 1776) (Odonata, Libellulidae) are the same species

Abstract

TABLE 1. Primers used for PCR and sequencing in the present study. gene/markerprimer namesequence (5’ to 3’)referencehistone H3–H4 regionHex_ARATATCCTTGGGCATGATGGTGACMglinets et al. 2025histone H3–H4 regionLH4_2RTTAACCGCCGAAACCGTACAGGGTMglinets et al. 2025COI911TTTCTACAAATCATAAAGATATTGGFolmer et al. 1994COI912TAAACTTCAGGGTGACCAAAAAATCFolmer et al. 1994

Published as part of Kosterin, Oleg E., Vshivtseva, Ekaterina I. & Blinov, Alexander G., 2025, What was known as Rhyothemis variegata (Linnaeus, 1763) and R. phyllis (Sulzer, 1776) (Odonata, Libellulidae) are the same species, pp. 571 in Zootaxa 5725 (4) on page 571, DOI: 10.11646/zootaxa.5725.4.7, http://zenodo.org/record/17870208

Related Organizations
Keywords

Biodiversity, Taxonomy

  • BIP!
    Impact byBIP!
    selected citations
    These citations are derived from selected sources.
    This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    0
    popularity
    This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
    Average
    influence
    This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
    Average
    impulse
    This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
    Average
Powered by OpenAIRE graph
Found an issue? Give us feedback
selected citations
These citations are derived from selected sources.
This is an alternative to the "Influence" indicator, which also reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Citations provided by BIP!
popularity
This indicator reflects the "current" impact/attention (the "hype") of an article in the research community at large, based on the underlying citation network.
BIP!Popularity provided by BIP!
influence
This indicator reflects the overall/total impact of an article in the research community at large, based on the underlying citation network (diachronically).
BIP!Influence provided by BIP!
impulse
This indicator reflects the initial momentum of an article directly after its publication, based on the underlying citation network.
BIP!Impulse provided by BIP!
0
Average
Average
Average