publication . Preprint . 2018

A multiplexed homology-directed DNA repair assay reveals the impact of ~1,700 BRCA1 variants on protein function

Jay Shendure; Justin Gullingsrud; Jeffrey D. Parvin; Lea M. Starita; Stanley Fields; Aleksandra I. Adamovich; Tapahsama Banerjee; Muhtadi M. Islam;
Open Access English
  • Published: 05 Apr 2018
  • Publisher: Cold Spring Harbor Laboratory
Abstract
<jats:title>Abstract</jats:title><jats:p>Loss-of-function mutations in <jats:italic>BRCA1</jats:italic> confer a predisposition to breast and ovarian cancer. Genetic testing for mutations in the <jats:italic>BRCA1</jats:italic> gene frequently reveals a missense variant for which the impact on the molecular function of the BRCA1 protein is unknown. Functional BRCA1 is required for homology directed repair (HDR) of double-strand DNA breaks, a key activity for maintaining genome integrity and tumor suppression. Here we describe a multiplex HDR reporter assay to simultaneously measure the effect of hundreds of variants of BRCA1 on its role in DNA repair. Using this...
Subjects
Medical Subject Headings: skin and connective tissue diseasesendocrine system diseases
free text keywords: Homology (biology), Computational biology, Genomics, Biology, Multiplex, Homology directed repair, DNA repair, Genetic testing, medicine.diagnostic_test, medicine, Missense mutation, Reporter gene
Funded by
NIH| Comprehensive Biology: Exploiting the Yeast Genome
Project
  • Funder: National Institutes of Health (NIH)
  • Project Code: 3P41GM103533-20S2
  • Funding stream: NATIONAL INSTITUTE OF GENERAL MEDICAL SCIENCES
,
NIH| Interpreting Genetic Variants of Uncertain Significance
Project
  • Funder: National Institutes of Health (NIH)
  • Project Code: 5DP1HG007811-02
  • Funding stream: NATIONAL HUMAN GENOME RESEARCH INSTITUTE

0 GGCTCGGAGATGTGTATAAGAGACAGCTATGAACTAATGACCCCGTAATTGATTACTA  

Abstract
<jats:title>Abstract</jats:title><jats:p>Loss-of-function mutations in <jats:italic>BRCA1</jats:italic> confer a predisposition to breast and ovarian cancer. Genetic testing for mutations in the <jats:italic>BRCA1</jats:italic> gene frequently reveals a missense variant for which the impact on the molecular function of the BRCA1 protein is unknown. Functional BRCA1 is required for homology directed repair (HDR) of double-strand DNA breaks, a key activity for maintaining genome integrity and tumor suppression. Here we describe a multiplex HDR reporter assay to simultaneously measure the effect of hundreds of variants of BRCA1 on its role in DNA repair. Using this...
Subjects
Medical Subject Headings: skin and connective tissue diseasesendocrine system diseases
free text keywords: Homology (biology), Computational biology, Genomics, Biology, Multiplex, Homology directed repair, DNA repair, Genetic testing, medicine.diagnostic_test, medicine, Missense mutation, Reporter gene
Funded by
NIH| Comprehensive Biology: Exploiting the Yeast Genome
Project
  • Funder: National Institutes of Health (NIH)
  • Project Code: 3P41GM103533-20S2
  • Funding stream: NATIONAL INSTITUTE OF GENERAL MEDICAL SCIENCES
,
NIH| Interpreting Genetic Variants of Uncertain Significance
Project
  • Funder: National Institutes of Health (NIH)
  • Project Code: 5DP1HG007811-02
  • Funding stream: NATIONAL HUMAN GENOME RESEARCH INSTITUTE

0 GGCTCGGAGATGTGTATAAGAGACAGCTATGAACTAATGACCCCGTAATTGATTACTA  

Any information missing or wrong?Report an Issue