Phylogeography of two lusitanian sea stars

0044 English OPEN
Darrock, David John;
  • Subject: QH426

The first comprehensive genetic study of North East Atlantic and Mediterranean sea stars, Asterina gibbosa and Asterina phylactica, is presented here, based on mitochondrial DNA (mtDNA) and Amplified Fragment Length Polymorphism (AFLP) data. MtDNA analysis revealed that... View more
  • References (41)
    41 references, page 1 of 5

    I 1 0 20 30 40 50 60 I I I I I I I GTTGTCTCCTGGTTAACGGCCAATTGCCTTTCCATTAGGCTACAACCCAATAGAAAGTAG GTTfrrCTCCTGGTTAACGGCCAATTGCCTTTCCATTAGGCTACAACCCAATAGAAAGTAG ----------------------------------------------- CAATTGCCTTTCCATTAGGCTACAACCCAATAGAAAGTAG -------------TCCTGGTTAACGGCCAATTGCCTTTCCATTAGGCTACAACCCAATAGAAAGTAG --------------------------------------------- CCAATTGCCTTTCCATTAGGCTACAACCCAATAGAAAGTAG -------------TCCTGGTTAACGGCCAATTGCCTTTCCATTAGGCTACAACCCAATAGAAAGTAG ----------------------------------------------- CAATTGCCTTTCCATTAGGCTACAACCCAATAGAAAGTAG -------------TCCTGGTTAACGGCCAATTGCCTTTCCATTAGGCTACAACCCAATAGAAAGTAG ------------------------------------------------------------------------------------------------------------------------------- GTAG ---------------------- GGTTAACGGCCAATTGCCTTTCCATTAGGCTACAACCCAATAGAAAGTAG (AFLPs) and m itochondrial 16S gene sequences. Fresfni'ater Crayfish, 12, 396-412.

    He T, Frauss SL, Lamont BB, M iller BP, Enright NJ (2004) Longd istan ce seed dispersal in a m etapopulation o f Banksia hookeriatui inferred from a pop ulation allocation analysis of am plified fragm ent length polym orphism data. Molecular Ecology, 13, 1099-1109.

    H olsinger KE, Wallace LE (2004) Bayesian approaches for the a n a ly sis o f p op u lation g e n e tic structure: an ex a m p le from Platanthera leucophaea (O rchidacea). M olecular Ecology, 13, 887- 894.

    H olsinger KE, Lewis PO, D ev DK (2002) A Bavesian approach to inferring population structure from dom inant markers. Molecular Ecology, 11, 1157-1164.

    H unt A (1993) Effects of contrasting patterns o f larval dispersal on the genetic connectedness o f local p op u lation s o f tw o intertidal starfish, Patiriella calcar and P. exigiui. M a rin e Ecology Progress St'ries, 92,179-186.

    H unter E, H ughes RN (1993) Self-fertilization in Celleporella hyalma. M arine Biology, 115, 49 5 -5 0 0 .

    Isabel N , Beaulieu J, Thierault P, Bousquet J (1999) Direct evid en ce for biased gene diversity estim ates from dom inan t random am plified polym orphic D N A (RAPD) fingerprints. M olecular Ecology, 8, 477-483.

    Juan A, C respo MB, Cow an RS, Lexer C, Fay MF (2004) Patterns of variability and gene-flow in Medicago citrina, an endan gered endem ic o f islands in the western M editerranean, as revealed bv am plified fragment length polym orphism (AFLP). Molecular Ecology, 13, 2679-2690.

    Laitung B, C hauvet E, Feau N et al. (2004) G enetic diversity in Tetrachaetum elegans, a microscopic aquatic fungus. Molecular Ecology, 13, 1679-1692.

    Lo Brutto S, Arculeo M, Parrinello N (2004) C on gru en ce in genetic markers used to describe M editerranean and Atlantic p o p u la ­ tions of European hake (Merluccius merluccius L. 1758). Journal of Applied Ichtyology, 20, 81-86.

  • Metrics
Share - Bookmark